Open Close
General Information
Symbol
Dmel\Hipk-RA
Species
D. melanogaster
Annotation Symbol
CG17090-RA
FlyBase ID
FBtr0072552
Feature type
Associated gene
Evidence Rank
Length (nt)
11261
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 76 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        CAGAGTCTCCACAAACGGCTTCGCGAGCGGACGTTGCAGCCACAGAAGATACAGCCACGGCCGTCGAGGAAGTGGCAGCT
        ACAGAAAGCCAAGATATATATCTGCATATACATATGACTGGCGAAGCTGCTGCGAAAAAGATTCTCTTTTAATTTGGCAT
        AAATTGTATTTGTCTTGAAAAAAGCATATTCTTGTAAATATATCCTCTTCGTAAAATATTTTACTTAAAAGCCTTAAAAT
        ATTGAATTCACGTGAAATTTCAAACGGTGTCACTCGAAATTCGCCAGTGACTCGCCGCCACGTTTTGTACAAACATAGTT
        TGTAAACATAAGTTTGTAAGCGGCCGGAAAAAGGCGAACGGAACCCAAAAACCCCAATGCAAGCCAACTGAGTGCAAGGG
        AGACAGCCGACCACGTCGAGCGGGATAGCATGCGCCAATGAAAACGTCCTACCCCCCAAAAGCGTCCGATTTCGTTGACT
        ACGCCGTTGCCGGGGGCGGGGGATCCGGATTCTGTTCGGGATTAGGAGCGGGACTTTCAGTCAGGGCGACGTCCTTCTAC
        GGCGATCAAACGGTAACGGCAACTACGGACGGGACGCGTCACCAGGAACAACAACAACAACAACTGCAGCAGCAGCAACA
        GCAGCATATCCTAAGGCAACCTGCAACATCCGCATCGACTTCATCGGTAGCTGCAGCAGCAACCAGCAAGCGAAAACGTC
        AAACAGATTGTGATTGCGGCTGCGTCGACTCATATAACTCCAGCCACGGCCCGCCAGTGCAGCAGGACTCTTCAGCAGCA
        GCGGGAGCGGGATCTGTGGGATCGAAAGCGGGATCAGGACCAGGACCAGACGGAATCGGGCCCATCAGCAGCCTCAAAAC
        GGCGCACACAAAGGTCGCCACCTCGGGGGGTCATGCCAACACGCAGCCCCCCAGCAAAAGGTCGAGCAGTGGAGCGGATG
        GCGACTACCAGCTGGTGCAGCACGAGGTGCTCTATTCCCTATCGGCGGAATATGAGGTCCTTGAGTTCTTGGGCCGCGGC
        ACCTTTGGCCAGGTGGTCAAGTGCTGGAAGCGCGGCACCTCCGAGATCGTGGCCATCAAGATCCTGAAGAACCATCCTTC
        GTATGCGCGGCAGGGCCAGATCGAGGTATCGATCCTTTCGCGCCTCAGCCAGGAGAATGCCGACGAGTTCAATTTTGTGC
        GGGCCTTTGAGTGCTTTCAGCACAAGAACCACACCTGCCTGGTCTTTGAGATGCTGGAGCAGAACCTTTACGATTTTCTC
        AAGCAGAACAAGTTTTCGCCGCTGCCGCTCAAGTACATAAGGCCCATTCTGGAGCAGGTATTGACTGCCCTGTTGAAGCT
        GAAACAACTGGGTCTGATCCATGCCGACCTGAAGCCCGAGAACATCATGCTGGTGGACCCAGTGCGTCAGCCCTACCGCG
        TCAAGGTGATCGACTTTGGTAGCGCCTCTCACGTGAGCAAAACGGTCTGCAACACGTATCTGCAGTCGCGCTACTATCGT
        GCTCCCGAAATCATACTGGGCCTGCCCTTCTGTGAGGCGATCGATATGTGGTCACTGGGCTGCGTGGTGGCAGAGCTCTT
        CCTCGGCTGGCCGCTCTATCCGGGCAGCTCGGAGTTCGACCAGATCCGCTACATCTCGCAGACACAGGGATTGCCCACAG
        AGCACATGCTGAACAGTGCCTCGAAGACCTCCAAGTTCTTCTACCGCGACGTGGACTCAACGTATCCCTTTTGGCGCCTG
        AAGACCACCGAGGAACATGAGGCGGAGACAAACACGAAGAGCAAGGAGGCGCGCAAGTACATCTTCAACTGTCTTGATGA
        CATTGGGCAGGTCAATGTGCCCACTGATTTGGAGGGCGGTCAGTTGCTGGCAGAGAAGACGGACAGGCGAGAGTTTATTG
        ATCTGCTTAAACGCATGCTGACCATTGATCAAGAGCGGCGACTCACGCCAGCAGAAGCGTTGAACCACTCGTTTACACGG
        CTGACCCATCTGGTTGACTATGTCTACTGCAACAATGTCAAGGCATCCGTGCAGATGATGGAGGTGTGCCGCCGAGGCGA
        TTTCCACACTGTGCAGCCTGCGTCGACGCTGGTGACTAATTTTGTGCCCTCGAGCACAGAGAACATGACGTTCACGATCA
        ACAACCAGTTGACCAGCCAGGTGCAGCGCCTTGTGCGCGATGGGCGTCCTTTGGCTTACGAGGGACTCTACCAGATCTAC
        AACGGACGCAGCGTGGCCCGACAGTATCCGCAGACGCGGACTGATAGCTTCCAGCACCAGCTGGTCTCGAACATCCTGTG
        CCCGCCCTCGTACCAGACGATGCCCAGTCCCACTAAACATGTGGTGGTGGGCAGTGCAACCATGCAGCCACCGTTGCAGG
        TCCCGCCGCAGCAGTACGTTAATGTGCCCGTACCAGTTTCCATGGTGGAGCCAACATCTGGTCAGAGAATGCTTCTAACG
        AACCGTGTGCAGGCCAGCGGAGTAGCCTGGCCACAAACTGGACGGCAGATGGCCTTGGTGCCGTCGTGGCCCCAGCAGGC
        GCCCGCCCACTCGCTCATCGTGGACTCGACGCCTCTTTTTAATGTGGAGGAGATCTATCCCAAGCACCACCTCAACTTGC
        CACGCAACGATCTCAAGAAGGAGTCGCCGGCTCATCATATTGCCAAGGGGAACTCTTATCGCGTGCCGCGCCACGAGAAG
        AAGGAGCACCAGCAGTTGTCGCCGGTGAAGAAGCGGGTGAAGGAAAGCTCGCCGCCCCACCAGCAGCGGTACCAGCGCGC
        TGCACACGTTTCGCCGCAGTATCACGCGCACCACAACTGCAACTACGGGAATGGCAGTGGTTACAGCGCCAGTGCCGGAT
        CGGTGGTGGCCTCCTCGGCTGCCTCCTCTAGCAACATTGTGAATGGAAGCTCGTCGAGTTCGCACCATCATCACGTCCCC
        GTCGCCCATGCCCAGCCCTACAGTAGCTCCTCAGGTCACCACATTGTAAGCAACTGCAACGCCAACGGAGGAGCAGGAGG
        AGCAGTGGTTTACCAACAGCCACCGGCTCATGCCCATCAGCAGCATGGGCAGCAGCCGCATCCGCAGAGTTCGCAGCATC
        CGCAGCACGTCAAGCAGCCGACAATAACCATCCACGACACGCCCTCGCCCACGGCTGTGATAACGATCTCGGACAGTGAG
        GACGAGGGCGGAGAGGCTGGAGGAGCTCAGGTACCGGTGCTAAAGCAACGGGCGCATGCCCAGTCGCAGACCAGTGGTAG
        TCTGCTACAGCACGCACCAAGCTCGTCCTGTAGCAGGAGCAGCGCCCACCAGCAGCCGCATCCACATCCCCAGCAGCAAC
        AGCAGCAGCAGATAAACTATGGTGATCATGATCCGGAAGATGCCCGCCGTCGTCATCATGCCGCCGCCGCAGCCGCCGTG
        GGAAGTCCCAAGCATCACCATCATCAGCAGCAACAGCAACCTGCTCCTCCTCCACAGCAGCAACAGCAGCAGTATCAGCC
        ACAGCCACCGCCGCAGCAGGTGTTGCCCCAGCCACAGCCCAGCATCAAGTATGAGCCCGGCCAGTCGCAAAAGAAACGCA
        TCTTGGCCATGGCTCAAAGCGAATGTGGCTACCAACCTCAGGTTCCCAGCCAGCCGTCGTCTTCGGCCAGTTTGCCGCAC
        ATTCCCACCAAGCAGGAGCCAGCCGAATTTTATCCGGAGTATGCAGCTGCTCCGCCGCAACAGTTAGACACAAAGCGCTC
        CTCCTGGGCACCTACATCTTCGGGATCAGGAGTGTCCGCTCTCCCGCTTGCTCATCCAAAGCGAGAGGCCCCCTCTGTAG
        CTCCCATAAGCTATGTAGCCCCGTCTGTGGCTCCGCCATTAGCCCACTCCAAGAGCAGTTCCGCATCATCATCGTCGTCG
        ATAAGCGCTGCGACTGCCGCAGCAGCTGCTGCAGCTGCAGCGGCGGCGGCCAGCGTTGGTCCTCCATCGTGGGGTCCTCC
        ACAGGTCTATCGTCAGCCATCACAGCCGCCTCCGGGCAGCGTGGGACTACCAGGAAGCACTCAGCCGCCGCCGTCGAGTG
        TGGCCCCGCATCCGCATCACCACAGTCATGGACATCATCATCACCAGGCCGGAACACCGCTGGGCGGATCGCCATCATCA
        ACGGCGGCGGCCGCTTTGTTGCAGCCCGATATTTATGCGCAAGGCGACATTTACCGCCGGCCCACAGTTTTCGTATCACA
        GGCGGCCCCCAGCTATGCCTACGCCAACCGGGCGGTGGTGGCTCCACCTCCGGCCCACAACAGCTCCAGTCGTCAGGTGA
        TACCATCGCATCCGCTGCCAGCTCACATTCAGATACCCACACAGTACAGCCAGTTTGGACCGCTCAGTCCTGCCCAGGTA
        GCCGCCAGCAAACACGCGGCGCACTTTGCGCCCACCAACATATGGTATGGGGCTGAGTAGACCGACGATGGGAGTTGACG
        GGGAGAGGGGCGATGAGGAGAGACGCGGGACGAGGATGTGCACCCACCCAGAACCAAGAACCACCCAACTACACACCGCA
        CAACACCACCATCACCACTGTTGTTATGATCTTGAGCTAGAGCCCGATCGAATGATTCAACGCTCGAATCTTTTGTAGCC
        TCGGGCGAGGCAGGCGACAATCCGGAGCAAAGCCAAGAGCTGCAGCAACATCAGCTGCAGCTAACTCAGTGCTGGTGGTT
        CATGCTACTCATGCAGCAGACTATAATCCAGAACAACTCCATATTCCAAGCGGGCAGCGACGACGCCGCAGCAACGGCAG
        CAGCATCCTCAGACACAACCACAACACGTAAAGCACGACGGCAACATTAAGCAAAGTCCAAGTCCCCTAACTCATTGCCA
        CTTCTTAGCTTATTTTTTTTCGGGGTCCCGCGGGATCTCATTTCTGCTACTATTAATTTTTATTATTTTTTTTAAATAAT
        ATTAAATATAAATGTAAAGCACTCCTACACGCAGCTGGGTGTACAGTGCTCAGGCAAACTTTTGGCAAGTTGTGCATCAG
        CACAATTTCGCACCCACACACACTACAGCTATAGCTTCTATACCCTCGAAATATGCCAGTTAGATGCATATCGAGAGATG
        TTTTTCTTCGAAACGAAAGCGTTTTATAAATGTGTGTTTTATTGATAATTTCCAAATAATATTCTCTATAATCTACTTAT
        ATATTATATACATGCATATGTAACACTATTATTATGAATACTATATATCAAGAGAAAGCTAAACAAAACTAGAGTTTACG
        GCACGTCGACAACTGCAACATTAGGCCAGAGAGCCAGTAAGAGAAAGCTTCGAAATTCCCTAGCAAGTACCTCAGAAAAT
        CAAAAACCTAGCAGCAGCAGCAGCAACAACAGCAACCAGATAAGAAAATAAACAACATTGTTATGCAATTTGCCTTTTAC
        ACAAAACAAGCAACAAAAGAAATTGAGATGACGAAAGACGTTGAAGATTATGATTATGATGCAGGAGTAGAGTTAGACGA
        GGTTAGTAGAGAACCACAACAAATTGAATACCGCAAAAACCTTACTAGCAAACAAACAAACAAATAAAATAGATACCCTA
        GGAGATATCAACAAAGAGAACTTAACAATTACATAGCTCATAGATTTAGTGGATAGAACGGGAGAAGGTCAAAGGGCGAA
        CGTTTTTTACACACTCGTAACTCACTCATAGGAATAGCCGAGAAAAGAATTACAACTAACAACTAACAGATAACAATTCT
        AAATTATGTTTAACGAGCAACAACAAATAATTATAGGAGCAAGTGTACATAATACGCATATACTTACATATATCGGTACT
        AAAATTAGCCGGAGCCCAACAAAAAGCCGATTTTAAAACTGATCAGTTGTTAAAGTCAGGTCAGCGAAGCCAGTTAGTCT
        GCGGTACGCTTAATTTTTAGACTTCACATTTCGTTTTACCCCATCTGTGTCCTGGAAGAAGATCTGCGTTTTGGTTATTC
        TTTTAAATAGGAAAGCGCATAGGAAAGTTTACTAAAGTACAAAACCAAACAAAAATAATAAGCAATCTAGCAGTTTAGGC
        TTTTAGTGTTTGTCCCACTACAACCCCTTGTTTTAGACTTTTCCCCAGAGAAATTGTAATATATAGAATCCCATTTTGAT
        ATGTACAAACCTGGCTTACTTTAACTCGCCTACTATAGATCCTTAATATAAAATAATAAAAAAAAAAAAACTAAATCTTG
        TTAAATAGGTTTCCTAAAGTACTTCGTAGTTAGAATTAAACTTAACTTTCGCGATAAAATAACCAAGCAGCAACTAATTT
        TTCGCCCTCCTGGGGTCGATTACTCGGTTGTCCCAACCGAGAATTTATTAAAATCGGTCCTTCGAGGGAGGCACTTCCTA
        TATAATGAATTACATGCTGATACAAAGCAGAAATATTTAAACCATCCTTCGCCCCTTCCTAGATCAGCTGTGTACAGTAG
        GCTATTTTGGGATCGGGATCGAGATGAATCAACTCCGACGATTGGAAAAGATCTAGCATATAATTATTGTGATGTAGTTT
        TTAACGAGGAGCAGAGAAGTCCGCAAACGTTTTTTGTCAGTCGTCGTCGTCGTCGTCGGCGAATAGAAATTACCTAAAAT
        TACGAATAACCAATTGCGATACGGATACGGAATATGCATCTATATGTTAACTAATTAGTGTGCAGGATTCAATAGCGTTA
        GCACGACAACAAAACGTTTTTTTAACCAAGCAAGTACATTTTTAAAAAGCGAGTAATAACACTTTTTGTAGTAGGAAAAG
        GAGAACAATTGTAGCATACATAGACGTAATTAAGAAACGTTAGTGTTGTGAATATATACGAGTAATTACAAAAACATAGA
        GAACTAGATTCTACCCGTGGTTCGAGTACATTTATATTATGGATATATTTTGTGTATAAACAATAACGGCAACCAGCAGC
        TAACAATTGTAATTGTAATAAACAATAAACGAAAACCACAACTCGGCAGATTTAAGATTCTTGTTTAAAGTCGAGAGAAC
        CGTATCTAGATAATAGTCTTAGATGTATTCAGCAAGTTCTTTTTTTATAGAAATTTTATGGACCATTCAACTAAAGCATA
        TAGTCAAATAAGCATGAATATTGTATAAAAACAGCTGTGTGACCGTTTAGATGTCAGCGGAAAGTTGCGATCTGTGTTTC
        CGATTTGTGTTTCTTGTCCTGCACCCACTCAGTGTGCGAACTTATACTTATATTATATGTAAATGTATATGCTAAATATC
        TGCGAGGGCAGACGAACTTTTCTTCTCTTTCTACTCAATATTTAGGAGCATCAACCAGAAAGCAAAACCGAGAAAAAAAA
        ACAAGAAAACAAATCATGAACGCTTTAAATGTAACAAAAACGAAACGTTAATAGACTTATGAAAACAACAAACAAATTAA
        ATTTATATTAAACGACAAAAAAATAAATTTATATTAACAAACAAACAAATTACATTTATATTTAAAGAAAATCAACAACA
        AATTAAAGTTATATTAAACAAACTCACACTCAACAAATAAATAAGCAGGCAGGTGGACCACGGTCGTTAGCAGACTTTTG
        TGGCCCACTGTCGGAGGACTTGTATTTAGGAGGAACTCTGGGTGGCTTTCACCACCAGCGAAATGCGGAGAGATCCGCAC
        AAACACTCTAATATACGTATATATTTAAATGAGAAATGTTTTAACTGTGTAGCCTTAGTATTTGTACTCGTCGTCCTCTC
        GATTTCCGACAAAAATATGATGATATACGATACTGTAGGGCAAGCAATGCCGATCGATGTTTACTAATATATTTCATATG
        TACTTGTTTAATCGTACTGAGTTCGGATGAGTTGCCCCTACTACTTTACTCTTTTAACCGTTTAAATTTACTTTTAATTT
        ACTTTGTTTCTTTGCTTAACTTTGTTTTATAATGGAACATAGCCACAACATATACCATATATATTGCTTATATTTACTTA
        TGTCCTACAAAATATAGAAATCGTAAATATACATAACAGATATCGCAATTTTCGTTTTTCTTTAGTTCTTTAGTCTCTTA
        TTATTTCGTTTTCTAGTGCTTTAAGAACAACTTAATCAAAAGCAAACGGAGAAGATGATGATGAACAACAACAAATACAA
        CATATATCCCACCAAATTACAAAGGAGTAAATAATTTTTAAGTTTAAACGATTAGTGAATTAACTTAATAATAATCGTAG
        TTATTGTGCAATAATATCGATAACGATTAGCCATTCAAAGCAAATTGTGCAAACAATTTAATTTTAGTATTGGGGACCTA
        GTAGTCTAGTTGCTCCCCGCAAGAGGCTAGCTTCAGCTGATTTAGATTTAGTTCAAGACCAACCAGGTTTCTGCAGATTA
        TAGATTGATTTCGCACGCCCCGCCCCGCCACACCCCTCGAACTTTGAACCACCCCCCACGAAGTTGTTTGATTGACCAAC
        AATTGATGAGCTTTTACCGGAAAGTAAAGATATTTTGTTTTGCATTTACCAAAACAGAGCAAGCGAAACCGAAAACGCAC
        CGAACCGGAACCGGAAATTCAAAACCAATCTGTAACAGATGGGTTGAGGGAGATTAGAGGAGTTGACAAACAAGATTGAT
        AAGAACCCGTCCATAATTAGATTTCTTTCGTTTGAGCTGGACCTGAACAAACTGAAACACGCACTTCGGACAGCTGGAGC
        GAGATCCAAAAACTTAGCAGGGGCCCTCTCCTACTTAATGATAGCATAATTTTACGAATGCGGATAATACCGACTTAGTA
        GGCTACCAGTAACTTAATTACGATATTGATAACCCCTTCGTGTTTCCTTCACTTGAAGAACTTTCTAAACTCTCTTAAAA
        ATTGCGGTTCGGATCGACATTAGAAGTTTTTAATACACACACAGAATATATGTATATGCGGATATATTTTATTAACTAAG
        AAATTATTTCCTAGGCAAGAGGAGAGATCATAACGATAACCGAAATGTTGATGTGTGAAATTTATAAGACTAGCATATTT
        CCTACCTACAGAAAACCAAATAACAGAACAATATGTGTTATATATACTCGTATACACGAAATATGATAAATAGCAGCTAG
        AGCTGAGATCATACTCACAGTCGTACATATAAGCGCTAAGGCAAATACAGATAATTATAATGAGATATTGAATTTAAATG
        ATCGTACCTTTTGCTGATTTCAAAACAAGCCAGAATTTGAAAAGGCCAGAGCAAAGCGGAGTCATTGGGTGATGAAAACG
        TAATCGAAACAATATATGTTTTAATAGAGATCGGAGAGAGCACTTTTATGGGATTTGCTTTTTATATACATATGAAATAT
        ACGAAAATATAGATGTACTTATAGCGGTGGCAGCCCGCACTTTGGGCGATTGCGCGTTTCAGATTAAAGAATTTAAATAT
        TTTTATATACGAACTCGAGTAGAGACTCCATATACATTTACGTTTAGCAAAAATAGCGAGTAGAGGCCAGGCTTTGCATT
        CGATTACAAAGTGAAGAGGAAGCAAACCAAAGACGGATAATCAAAGTGCGCGCACACTCCACTCACCAACACACAAGAGA
        CTCTGAATCACTCACCACACCACGCCACGCCACACCACACCACCCCCCACTAGTGTTTCTTTCTCGTGGGCACCAAGTCA
        TATTCATATGTGGTACATGACCCCTTGACCCCTAGTCCTAGTATCAACATTACGAATCCCCGACCTCAGATTTGATAAAG
        GGATCCCTGGGTTAGACAACAACGAATTGCCGGGCAAGTGGAACCAGGACCTCCTGTCCCAAGAACGCAACCCGCAAAAT
        GAATGTTTTCGATCATCAACGAAGAGATTTGACCTTGCACCTTCATTTAGTCAAAGTCAACTCACCAACACACAGACACC
        TCAAAATGTTTCATCAAAACAGCACCTTAATGAATGTTTCACCAACATATAACTTAAAGTTGAATTTGAACTCAACAACA
        CCTCATTACAATCTCACCATTACAGCATCCAAGTATTCAACAAAACACTCAACCACAAAAACTCTAATCGTACTTAATCA
        CTCTTTTTGTATCCTAATAGTATTTCAATGAACGTGTACTGAATGTTTTTACTTGGTGTCCTCTCTTATTTAGGCTTAAG
        AAAATCGAAATCGAAAGAAACGGAAATGAAATTCAAACTTATATCAAAAACCAAGCACACCGATACATTTAGCATTGTAC
        TTGATAAGCTATCGATACTAGTGTTAGATGCAAATCAAAATATACACACTCCAATTAATAAGTGTATCTCTCTGTCTTAT
        TCTGATATGCGTACCTTTTTGAGGGCCCCCAAGATATTAGGAGGCCAGCTAATTTATCAAATACAAATAATCGTAGTCAT
        AGTGAATGAATTGAATTAAAAGTCTCGAGACCAAACCAAAGCATAGCAAAGCAAACCCAAATCCAAAACCAATCAAACTA
        AACGAAACAATGAGCCGCGACGTTTGTATTTATGTATAGAGTTCCCTCCCTAATCAACAGATAATACCTATAACAATCGA
        GTTCCGATTTCAGAAGAGTTAGGCGGCAATTAAGCAAGAAATACAAGAGGTACAGATTACTATAATGGTAATAATAAGGA
        TTAACTCAAGTTACGTCAACTTAGTGGCAGTGTAAACGCGTCTAGATAATTAATAGATATGAATAAGAACTTTTGACTTT
        TATGGCTGTTTAGAGATTTTATAATACGACTATATCGATATAGAATTATATACATACACGATATAAATTAAGCCCAAAAA
        TTTGCGTAACTTATTTACATACTCAGACACAAACATACGTCACACGACAAATTAACTTTAGTTCCCCCAAATGATTTTCG
        GCTAGTTCTGGCTTGGAATACCGCTCCCAATCCCATCTTCGGAAATTTTGGGGAGTGGGAGTGTCCTCTGCATCCCATGG
        AGGGAATGAAATCGAACATTGTGAAATTTAGTGTCTTTACACTTTAAAGAGAATATATACAAAACGGATTAATTAAGAAA
        CTTGAAAATCACACAAGGCGAAGTGCAGATACAGATACCGAAACAAATGCAGATACACCTACACAAAGATGCAGATGCAT
        ATAAATTATGGTAATTACATACTCTCGTACATATGCCTAAAAGGATACACGTGTAGTAATCTACAGCCACAAAAAAACAA
        TTAAAAATAAATGTCTATATATGAAACGAACAAGATTTAATGTGCGCAATATGCGTGTATC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0072551
        6287
        FBtr0331786
        5608
        FBtr0479798
        6104
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0072451
        1340
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0072450
        1340
        FBpp0304171
        1256
        FBpp0428131
        1409
        Comments

        Extended 3' UTR based on RNA-Seq data.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (3)
        Reported As
        Symbol Synonym
        CG17090-RA
        Hipk-RA
        hipk-RA
        Secondary FlyBase IDs
          References (2)