Open Close
General Information
Symbol
Dmel\mrva-RA
Species
D. melanogaster
Annotation Symbol
CG8602-RA
FlyBase ID
FBtr0076884
Feature type
Associated gene
Evidence Rank
Length (nt)
2570
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 79 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      CAGCGAGTTGGCAGCCCCGCCATTGTATATGCGTAATTAACGTTAATTAGGCAGAGGAAAGAATTTAGTTTTATTCGATC
      AGCAATAAAGTGCGGTTGCACACGTCACCGAACATTTGTTGCCCAACACCGCACTGCGAACTTCAGCTGCAAGTGGAGTG
      GAAAAACTGCTGATAACCAGTGAACCCAGAGACAACTAACTAGCCCACACAGCCAACAACAACAATAGTTGTTAGACAAA
      GGGTACTAGTACAGTAAACAAAAACAAAAGCAGCGAGATAAGCCAAGACAAAGCAGAAGAGTTCAACTCGCTCACTCGTT
      CGCAGAAATTGATACAAATATTTTGCAGAAACGGCAAATACGAAAAGAGAAAAACGAAAGCAAAAGAAAAAACAACTGCG
      GCAGGAAATCAGAAAGCCGATTAATCATATCACATAGTTTTGCATACGCCCATTCTGCGGGATTCGGCTCCACATCCAAC
      TGGTCAGTGCGGATTGTGCCAGCGGTGAGTGGAGATGGCGCGCGAGGACGAGGAACGCATCGTGGACAATGAGGAGGTGT
      CGCGACCGACGGAGGAGGACCAAGTGGTCAGTCGGGCCGGTCGGCGTGACAATGAACTGAGCCTTCCGTCCGGCGGCTGC
      TGCATGCCCTCGAGCACGAGCCACCGGTTCATGGCTCTGGTGTTCATGTGCCTGCTGGGATTCGGCTCCTATTTCTGTTA
      CGATGCACCCGGCGCCCTGCAGAACTATTTCAAGAAAGATCTTAATCTGACCTCCGCCCAGTTCACACTCATCTACTCGA
      TTTACTCGTGGCCCAATGTCGTCCTGTGCTTCGTGGGAGGTTTCCTGATCGATCGACTGTTTGGCATTCGACTGGGCACG
      ATTATCTACATGATGATCCTGCTGGTGGGTCAGTTGATCTTTGCCTGCGGCGGCATTCTGGACGCCTTCTGGATGATGAT
      CCTGGGACGGTTTATCTTCGGCATTGGCGCCGAATCACTGGCGGTGGCCCAGAACAGCTATGCGGTGCTCTGGTTTAAGG
      GCAAGGAACTGAACATGGTATTCGGCCTGCAGCTGTCGGTTGCCCGATTCGGCAGCACCGTCAACTTCTGGGTGATGCAG
      CCCATCTATGAGTATGTGAGCAATTTTTACAAGGGACATACCGCTCTAGGCGTCGTCTTATTGCTGGCTACCCTCACCTG
      TGTGATGTCGATGACCTGTGCCCTCATCCTCGGCTGGATGGACAAGAGGGCCGAGCGGATTTTGCAGCGTAACAACAACC
      CGGCTGGACAGATACCGAAACTCACCGATGTCTTTTCGTTCAAACCACCCTTTTGGATGGTATCCATCATTTGCGTCGCC
      TACTATGTGGCCATCTTCCCATTCATTGCCCTCGGACAGAATTTCTTTGTTGATCGCTTCGGGCTTTCGCCTGCTGAGGC
      CAACACCGTGGACTCGCTGGTGTATCTAATTGCAGCCGTATCGTCTCCGGTCTTTGGTTTCATCATCGACAAACTGGGTA
      GGAATGTGACCTGGGTGTTCACAGCGACACTGACCACCATTGGAGCCCATGCCCTGCTTACGTTCACCCAGCTGACACCC
      TATGTGGGCATGATCATCATGGGACTGTCGTATTCCATGCTGGCCGCAAGCCTGTGGCCTCTGGTGGCTCTCATCATTCC
      GGAATACCAATTGGGCACGGCCTACGGCTTCTGCCAATCGATACAGAATCTTGGCTTGGCGGTCATCACTATCGTGGCTG
      GAATTATCGTGGATCACAGCGGCGGCGAGCACATGTGGCTGCAGTTGTTCTTCATGGGCTGGCTGACCATTGCCCTGATC
      TCCACCGGCGTCATCTGGGCCTACAACAACAAGAACCGCGGTAATCTCAACATGACACCCCAGCAACGGGCACAGTTCGT
      CAGCGCCGAGAATTATCAGAACTTTGAATAGAAAGGGGGGGATACAAAGGCGAACGGCGCCCGCAGATCGGATTATTATC
      GGTTATTTAGTGTAGACATAAAAGTTACTCTCTGCGGGCAATGCGCCTTGGTCCGTTCCACGATGTGATGATGATGTGTG
      ATGTGCGTCTCGAGTCGCAAATTGGTATTTACTAACTGCAATTGTTTGTCATCCGACGATAGGGATATACAATACGCCCT
      GATCAGCCATGAATCAGTATTGATATGCGATTCGAGCCCGATCAGGCCGGTTTATATGCTATTTTACGCTATGTATTTTT
      AGATCAATTTATTATTAAAGTTAAAGTTACCGCATGTTTTTGTGTCAACGTTTTACAAATTAAACCAAACATTGAGACCA
      CAATTCCAACTAAATGTTTAATTATCACAAAAAACATTCAAGACTTGTGCGCCTAGAGCAACGAATTGCTATTTAATTGT
      AAATATGTACTCAAAATTATATCTCATTCATACAACTTGGTCGTTTGTTACTAGCATTCGCACGAGTTCGAAACTGTGTC
      CTGGTTAAATACAAATTAGTTAAATCTCCGTCATGATAACTATGTTTATACACATGCCTTTCTTCAAATAAAATGAATGT
      AAATTACGAT
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0332734
      2318
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0076594
      478
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0304980
      478
      Comments

      Extended 3' UTR based on RNA-Seq and/or EST data.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      CG8602-RA
      mrva-RA
      Secondary FlyBase IDs
        References (2)