Open Close
General Information
Symbol
Dmel\vri-RC
Species
D. melanogaster
Annotation Symbol
CG14029-RC
FlyBase ID
FBtr0079070
Feature type
Associated gene
Evidence Rank
Length (nt)
3058
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 18 )
cDNA Clones, Fully Sequenced
Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      ATGTTAAGTGATTTCTCAAGTGCGCTGTCTTGTGGCCAGCGATGAAAACACACAAAGCCCCATGGATTTCTCAGCCGTTC
      TGATAAGAGTCATAAATACGGCTAATTCCCCGCATCCAAGCTCAAAGCAACAACAGCCATCTGCAACACCAGCAGCAACT
      GCAGCAGAAACTAGCGCAGCTGCATCACTACAGCCAGCAGAAGCTGAGCGGCAGCGACTTTCCCTACGGGCCACGCCCCC
      CCACCGGAGGCAAAGAGGAGAAGCTGCTCCTGCTAGCGCCGCCGGGCAAACTCTATCCGGAGGCGTCTGTGTCCACAGCA
      ATGCCCGAGGTCCTCAGCGGCACGCCCACCAACAGCCACAACAAAGCCAACATCGCCATGATGAACAACGTCCGGCTATC
      CAATATATCGCCGACTCTCTCGATGAACGGCAGCTCCAACGAGGCTTCTAACTTGCATCCGTTGTCCATGTACGGAGGAT
      CCATAAGTCCGCAGTCAAATGACAGCGGCATGTCCGACAGTCTGGGCAAATATGTCCCGGGAAGCGGCTATGGAGATGGA
      ATGATGGCCCAGTCGCCCTCACAGGGTGGCAATGGACCGCAGTCGGCGTTGACCGCCGCCCAGAAAGAGCTCTTCTCGCA
      GCGAAAGCAACGCGAATTCACCCCGGACAACAAGAAGGACGAGAGCTACTGGGATCGCCGGAGAAGGAACAACGAGGCGG
      CCAAGCGGAGTCGAGAGAAGAGGCGCTACAATGACATGGTTCTGGAGCAGCGCGTCATCGAGCTGACCAAAGAGAACCAT
      GTGCTGAAGGCCCAGCTGGACGCCATACGCGACAAGTTCAACATCTCCGGCGAGAATCTGGTGAGCGTGGAGAAGATCCT
      CGCCTCGCTGCCCACCAGCGAACAGGTGCTGAGTAACACAAAGCGCGCCAAGATGAGCGGCAGTGGTGGCTCCTCCTCGG
      GCTCCTCGCCCTCGGGCAGTGGATCGGGCGAGGGATCGCCTCAAGGTGGCCACAATGGCTATCCGGTGGGTCCACCACTA
      TCTCCACTGATCTACGGACCCAATGGCAATGCCCGGCCAGAGGCCACGGTTAAGAGTGTCCACCACATACATCATGCGGG
      TGTTGCGCCGCCACCAACGCACCTACAACAGTTGGTTGTGCCCCAGTCCCAGACACAGCATCTCTACCAGCCACAGCCGC
      AGCAGCATCAGCCGCATCAGCAGCAGCAGATTTCCCAGCCACCGCAGCAACAACAGCAGCAGCAGGAGCCAAGTCCCAGT
      GCCGGCTCCAGTTCGCCAGTCATCTCCGATCCGCACAACCGCCCGCCAAGCACCACCATTGCCAATCTCCAGGTGCAACT
      GCAGCAGGCACTAAACCGCAATGTCAGGCCCGAGGATCTGGACAGCTTGCGCAAGGTGGTGGCCGCCGGCGCTCTATACA
      ATGCGGCAGCCGTGGTGGGAGCACCACCACCGCCACCATCTGCTGGTCTCTACGTGCCCGCTCCCAGCGCCTATAAGGAT
      CACCTGGAAGCGGCTGCAGCCTGGAGCCACAATGTCGAGGCTGCTGTGAGCAGCAGTGCTGTGGATGCGGTCAGTAGCTC
      ATCGGTGTCCGGCAGTGCGGCCAGTGTGCTGAATCTATCGCGTCGGGCCTGCTCACCCAGCTACGAGCACATGCTCTCCT
      CCACCACCTCCTCCACTCTTTCCTCGGCCTCCTCATCGGGAGCTGTTTCCGGCGATGATGAGCAGGAGCACGAACCAGCG
      CACATGGCTCCACTGCAGCTGCAGCGAAGCAGTCCGCAGCAGGGCAGCGATGCCAACAACTGTCTGCCCCTCAAGCTGCG
      CCACAAGTCCCATCTCGGCGACAAGGATGCGGCGGCCACGGCGCTACTCTCACTGCAGCACATCAAGCAGGAGCCCAACT
      GCAGTCGGGCATCGCCGCCGGCTTGGAACGATGGCGGCGACAATTCCAGCGACGAAAGGGACTCCGGCATCTCCATCGCC
      AGTGCGGAGTGGACGGCGCAGCTGCAGAGGAAGCTACTGGCGCCCAAGGAGGCCAATGTGGTAACCAGTGCCGAGCGCGA
      TCAAATGCTCAAGTCGCAGCTGGAGCGCCTAGAGTCCGAGGTGGCCAGCATCAAGATGATCTTGGCGGAGTAAGCAAGCC
      CCTGTCCAAGCTGGACAGGATCACGACTAGGCGGATCAGGAGAGAGAGCGAAGAGACAGAGGCTCTGAAGGGATCAGAGT
      CGGGGGAGCAGAGCAGTAGATGGCAAAGCAGAGAGTTCCATGGCGCCAGTAGTTCTCCTGGACAAAGAAGTTGGTTTAAG
      CATATGTTAGTAGAGATGTCCAAAACCGAGTGATAACTATTAGATACCGATGCATGCATGTCTCCATCTCTATGTAGAAC
      TCTAGGGCCAGGTCTGGACCACAAGGATTTGACACAAGACCCTGTGGCCCGAAACTGGCCAACACTTATCTGTGTGTATG
      TTTATCTATCCACTGTATTGAGTCTTGTAATCGTGAATGTTTAACTATATAGATCTCGTCAACTCGGAGCTAAAAAAAAA
      TCCTTAGGGTCAGCCCAAAAGAATTTCTAATTTAACCTGTTTGTTGTATACACACAAGCTATTTGTTTGCATAGCTAGCT
      GGTGACCTGCGATGAGCATCGGGGTCACCAGCCACGTTATTGTTCTCTTATGCATCCCAAGTTTCCTTATGCACAGCGAA
      AGTGGAGAAGATAAAGAATTATTATGTTTGTAAGCAAACGTTACAAAGTATTTGCTGTTGTACATATTACACAATTAATT
      ATATATACTATATAACTATACAGATATCTATATTCCTATCATGTACATAATTTTAGTTGCAAGCTAAGCTTATTTTATTT
      TATTTTATTTTACTTTGTATTGAGTACTATTATTATTATTATTATTATGTAGTGAAACAAACATATACATTACACTTAAG
      AAACGCGTGAAGCACATTCAAAACGTGAGAGATGAAAGAAATCTGAAAAGAATTGATGAATAAATTCTGCAATAAATAAT
      TTTAAATATCCTCCTACC
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0079071
      3841
      FBtr0300020
      3455
      FBtr0342936
      3890
      FBtr0346579
      4068
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0078705
      610
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0078706
      729
      FBpp0289297
      729
      FBpp0309715
      610
      FBpp0312171
      729
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      CG14029-RC
      Secondary FlyBase IDs
        References (2)