Open Close
General Information
Symbol
Dmel\foxo-RB
Species
D. melanogaster
Annotation Symbol
CG3143-RB
FlyBase ID
FBtr0082886
Feature type
Associated gene
Evidence Rank
Length (nt)
3939
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 27 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
    cDNA Clones, End Sequence Only (ESTs)
    End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      TTCAGTTGTCAGTTCGCATCCAACTAGAAAGCAGTTAACGAGTAGTCTGTGTTTTTTCGCTTGCGGTTAAAAGCCACGAG
      GTCGTTCATCGTTCATCGTTTTCCTTTTCAACTTCAAGCAAAGCAAATATAAACCAATGCAAAAAACGCAGTGATCTTTT
      GAGGCCCAAATCGTTTGGGGCCGAACACCGTTGATTCTAAAACGCAAATGTAGAAACAAATCAAGAAAGTGGAAAATAAA
      TATGTTTCGCTTTCAAAACATGTGAATGTGCCGAACTCAAAACTGAAACGTAGAAGGAACGCGTTCGTTTTTTACATACG
      ACAATCGTATAAAATAAGAGAAAAGCTCCAAAACGTATTAAATAGCGATGCTTGGATGATCTTCGTAGCAGTCACGTTGT
      ACATACAAATACATACATATGTACCTACTATATGGCACATAAAATACGTTACGCACACTAGTGGCGAATAAAAAGCGAAT
      TGGATTTCGCTCAAAACAACAACACAATCATATATACTACCCATAAAAAAAAAACAAACCCATAAAAAAGTGCAAAGCAA
      CCAGGAAAATAAAGTAAAACAGTGCCAGTTAACAACAGCAAACGGCGATCAACAAATCCCACCGGCAAAATCAACAATTT
      TTTAAATCGCAATCAACAAGGAGCAACAAATTAGCCAGCTATTTCCCATTGCAAACATTTGGCGGATTGATTGCGAAGCT
      TTCACATTCGCTTCGATATCTTTTGGGCTGGCGAGGATTGCTTGAAGAGCCGCAAAGCTGCAACTGCACAACGAACTTTT
      CTACCCCATGATGGACGGCTACGCGCAGGAATGGCCCAGGCTGACCCACACAGATAACGGCCTGGCCATGGACCAGCTGG
      GCGGGGATCTGCCCCTGGACGTGGGCTTCGAGCCACAGACCCGGGCCAGATCCAACACATGGCCATGTCCGCGTCCCGAA
      AACTTTGTGGAGCCCACCGACGAGTTGGACAGTACAAAGGCCAGCAATCAGCAGTTGGCCCCAGGAGACTCACAGCAGGC
      TATACAGAATGCGAATGCAGCCAAGAAGAACTCATCGCGTCGCAATGCATGGGGAAATCTATCCTATGCGGATCTCATCA
      CGCATGCCATTGGATCGGCCACCGACAAACGATTGACACTGAGTCAGATTTACGAGTGGATGGTCCAGAATGTGCCATAT
      TTCAAGGACAAGGGCGATTCGAATAGCAGTGCCGGATGGAAGAACTCCATACGTCACAATCTGTCGCTGCACAACCGCTT
      TATGAGGGTCCAAAACGAGGGCACCGGCAAGTCATCCTGGTGGATGCTCAACCCGGAGGCCAAGCCCGGCAAGTCTGTGC
      GCCGCCGTGCCGCTTCCATGGAGACGTCCCGGTACGAGAAGCGGCGCGGCAGGGCCAAGAAGCGGGTGGAGGCACTGCGT
      CAGGCGGGCGTGGTGGGCCTCAACGATGCCACGCCCTCGCCCAGCAGCAGCGTCAGCGAGGGGCTGGATCACTTTCCCGA
      GAGTCCGCTCCACAGTGGCGGTGGCTTCCAATTATCGCCCGATTTCCGGCAACGCGCCTCATCCAATGCCAGTTCCTGCG
      GACGCCTGAGCCCCATTAGGGCGCAGGATCTTGAGCCCGACTGGGGATTCCCCGTTGACTACCAGAACACAACGATGACG
      CAGGCCCACGCCCAGGCGCTCGAGGAGCTGACGGGCACAATGGCGGATGAGCTGACGCTGTGCAACCAGCAGCAGCAAGG
      GTTCAGTGCCGCCTCGGGACTTCCCTCTCAGCCCCCGCCCCCGCCCTATCAGCCGCCGCAGCATCAACAGGCGCAGCAGC
      AGCAACAGCAGCAGTCGCCCTACGCCCTCAACGGCCCCGCCTCCGGCTACAACACGCTGCAGCCGCAGTCGCAGTGCCTG
      CTGCACCGGTCCCTCAATTGCAGTTGCATGCACAATGCAAGAGATGGTCTCTCGCCGAACTCAGTAACCACAACAATGTC
      GCCCGCCTATCCAAACAGCGAGCCCTCATCGGACTCCCTGAACACGTACAGCAACGTGGTGCTCGATGGTCCGGCGGACA
      CTGCGGCACTGATGGTGCAGCAGCAGCAGCAGCAGCAGCAACAGCAACAGCTGTCCGCCAGCTTGGAAGGACAATGCCTG
      GAGGTGCTCAATAACGAGGCGCAGCCGATAGACGAATTTAATCTGGAGAACTTTCCCGTGGGCAATCTCGAGTGCAATGT
      CGAGGAGCTGCTGCAGCAGGAGATGAGCTACGGCGGCCTGCTGGACATCAATATACCGCTGGCCACGGTCAACACGAACC
      TGGTCAACAGCAGCAGTGGGCCCCTGAGCATCAGCAACATTAGCAACCTCAGCAACATAAGCAGCAATTCCGGCAGCAGT
      CTCAGTCTGAATCAGTTGCAGGCTCAGCTGCAACAGCAGCAGCAGCAGCAGCAGGCGCAGCAACAGCAGCAGGCGCAGCA
      GCAACAACAGCAGCATCAGCAGCACCAGCAACAGTTGCTGCTAAATAATAACAACAACAGCAGCAGCAGCCTGGAATTGG
      CAACACAAACGGCTACCACAAATCTGAATGCTCGGGTTCAGTACTCACAGCCCAGCGTGGTGACCTCGCCACCATCCTGG
      GTGCACTAGATCCACTGTGGGTCGATCGTAATCCAAATCGCAAGGATGATCGTTATAGCCGGTAGTCGTCGTTGTTGTGT
      GTGTGCGTGTGTGTTGTTTGTGTCGCCATTGGAATGCTTTAAACGCTAATTCTAAGAACCGTAGTGTAAAGAATTGTAAG
      CAGCCGCAGCTGGTTGGGAAACTGGAAACGAGGATTCGGATGCGGAGTCGATGTCTTTATCGGGTATGCAGCAGCTGCAG
      GATCAGTGAGCCGAAAGCGGGAGCCGCAGCTGGACCGTCACTAAAAAGTTTACAAAGATAAATCTGGTCGCTTCTAATCT
      AACATACATACATACAATACATATACATAGATATATAACTACAATTATATAGTTATGCATTACACATAGAAACGAAGCAT
      ACAAATAATACCAATTAATCACCAATAATTAGATGCTACAATTTGTGAAATTCTCTGAGTGGCAGAGAGCTGAGAAAACA
      TCTTTGGCCACCAATGAAGGGAAATTTGAATTGAATTGAAAACACGGTTTAGTTATTAGGTTCAACTTTGTACATATTAA
      TTTTAATAACCTTGACGTAATGAAACCCACAAATAATAATAATACTTCTAATGATAATAAACAACAAGAAACAGCGTAAA
      ACGTAAACTAAATGTTCGACAACTAAATGGAAAAATATTTGCTAGCCAGCAGTCATCGAGGAAAATAGAAACAAGAAAAT
      GGCAACAGAAAATATAAATGAAAAACATAAGAAATTAGCACAATTATGTAATAATTAATGCTTAATTAATGTATTTAATT
      GAAGGTCTAATTGTAATTGTATATTTTTTTCTATAAAGAGCAAAGAAAACCCTTAAAGAAGAATACAACTTGTGTAAAAA
      TTATGCTTAAGATTCGCAATGATATACGTAATAAATTCTCCGATTAGTTAGCACACATCAAATCAGCTCGGCTTTAAAAA
      TAAAACCCTTTGTTACATAATTATGCCAACATCCATATGTAGATCGTAGACCTATAACAAAGATTTGAGTGTAATACAAT
      TAATTTCATATATTATTAGTAAATGTAAATGTTGATAGGCAAAAGAAAAAAACAAAATTATAACAGAATAGCCACAAAAC
      TCAAAAACCCAGCAGAACTAAAAGCATAAAGTAATAAGCAAATAAATGCGCATCATTGTGTACTATTATGGGCTAAATGT
      TAATTATTAACTAGATTGTACAATTCAAATGTAGTTCATACTATTTAAAATGCAAAAACGGAGTGAAGATGAATAAACTG
      ATGATTCAATATAAGAATT
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0082887
      3548
      FBtr0305052
      3708
      FBtr0337094
      3450
      FBtr0346723
      3566
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0089343
      613
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0089344
      613
      FBpp0293589
      622
      FBpp0308010
      622
      FBpp0312334
      619
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      foxo-RB
      Secondary FlyBase IDs
        References (0)