Open Close
General Information
Symbol
Dmel\CG1358-RA
Species
D. melanogaster
Annotation Symbol
CG1358-RA
FlyBase ID
FBtr0088948
Feature type
Associated gene
Evidence Rank
Length (nt)
3374
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 27 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        CCCGGCCCAGACGCAGATCCCACAGTGCCCGCCAAAAGTCGGTTACCCTCTCTTCACTCCGGATTTACAGCTCAGGTCTG
        GCAAAACGTGGTGGTGTTCCGAATGTGTCACTAGACTCGGCGGCGATAATTCGAAAGGAAAACAGCAATAAACCCCGAAT
        GCCGAATGCCCTGCTCGTCTGGCGAGGCACGGCACTCGTAAAACAATCAAACGCCTGGCGAGTCGCGGCTCTTAACCAGT
        TCGCAATCATTTATCACTCCGCGCCTTTGGAGCTGAAGCGCAGGGCACTCGACGAGACACGGCTGTTTGGCTTACTTTGT
        CATCATCATCATCATCATCATCGTCGACTTGGCGAACTCGAGAATCAGCTGTTGGCGAACGAACCGAAAGCGTAGCGTTT
        TGCACATCAACATTCGCGCTCTTAAGCGGAGCGGAGCGTCGAGCGTTTCGAAATCAGTTTCAGTACCACTTTGTCCGTTC
        GCGATTGCGTGCTCCGTACCGTAGTCTTCTCTCCGGCGGAACAGCACCGCCACCAACGCCACCGCCATCAGCTGCTCGGA
        TCCGGACAAAAGAAGAAGAACGTGCCGAACCAAAGTGTCCAAGTGGGTACAGTGTGGTTACAAGCGGGCACCGACCCACC
        ATTAGGGCATGGTCATCGGTTTGGGACACGTGGAAATCCCCCTCATATGTACACATATACATACATATTACATATGTACA
        TATGTAAATATGTATGCGCGGTTGAAAGTCAATTTCCGTTGCCAGCCAATTCGGGAAGTTATTTGTGGTGATTCGGAAGC
        GCTGCATTGCCAGCTGCACTGAGCGAAATAACTAATACAAAAGCGATTTTAGAATGATCGAAATGGTGTTAAAGTCGAAA
        GTGACCAATAAAAAGGTCAAGTGCGTGGAGAAGTGATTAGTAAATCAGCGACATTCGTAGCGAGCTACAAAGACAGAAAG
        AAGTAAGAACCGCTTTCGAATATCAGTTTTAAGCAACCACGACTGCCCCGAAGGAATAGAGTGTTATATCCAGCCAGCAA
        CTAAACGGCACCACCGATCAGTCCGTCGCACCACCTGTTCCAGCTGCGAGTAGCACCACTTTCCAGCACCCACCCACTAG
        ATGGACCTGAAGCACAGTGCGGGTGGAGCTGGCGAGAACAGCGAGACCTTCATTGCCACCAGCAAGTCCACAGACATGAT
        CACGCCCAAGGAGAAGGAGGGCAAGGGGCTGAAGGTGGCGGGTGGCCATAACCCCCCAGCCGAAGGCTACAAAGTCTACG
        CCCGACGCTGGGCGGTGCTCATCCTCTTTGTGTTCTACTCATCCTCGAATGCCATGCAGTGGATACAATACACCATCATC
        AACAACATAATAACCCGCTACTATGGCATCAGCGACAAGTGGGTGGACTGGACGTCCATGATTTATATGATCCTGTACAT
        ACCGCTCATATTCCCAGGCAGTTGGTTTTTGGATAAAGTGGGTCTTCGCATCACCGCTCTAGTTGGAATCGTCGGCACTT
        GTGTGGGTGCCTGGATCAAGGTCTTCTCGGTGGACCCGTCGCTCTTCTACGTCAGCTTCATTGGCCAGTCGATCGTTGCC
        CTGGCCCAAGTGTGCATCCTGTCGCTTCCCGCGCGCTTGGCTGCGGTATGGTTCGGTCCGGACCAGGTGTCCTCGGCCAC
        CAGCGTGGGAGTCTTTGGCAACCAGCTGGGCGTGGCCGTGGGCTTCGTGCTGCCACCCATGCTGGTGCCCAATTCACCGG
        ATCTCGAGACGGTGGGCAGTGATCTGCAGATGATGTTCTATTTGGTGGCCGGGCTCACCTCTATCCTGCTCGTCCTGATG
        GTGATATTTTTCCAGGACAAACCACCCACTCCGCCATCCGCCGCCCAGGAGGCAGCCCAGCTCTTGGAAAGTTCCGAAGC
        GGAGCAAGTCAGCTTCATGCAGTCGCTGAAGAACCTGATGACCAACCGGAACTTCATCTTCCTGCTCCTCTCGTACGGCA
        TCAATGTGGGCGTCTTTTACGCCATTTCCACGCTCCTCAATCCGGTGGTGCTGAAGTATTATCCCGGCCACGAGGTGGAC
        GCCGGACGTATTGGGCTCAGCATTGTGCTAGCCGGGATGCTGGGCTCCGTGGTATCGGGCATTGTGCTGGATAAGACGCA
        CAAGTTCAAGGAAACGACGCTGGCGGTCTACGCGCTGTCCATGGTGGGCATGTGGATCTTCACCTTCACCTTGGACACGG
        GGCACATCGCGGTGGTCTACCTGACGGCCTCGCTGCTGGGCTTCTTTATGACTGGTTACCTGCCGGTGGGCTTCGAGTTC
        GGCGCCGAGCTGACCTTCCCGGAGCCGGAGGGCACCTCCTCCGGACTGCTGAACGCCTCCGCGCAAACCTTCGGCATATG
        CTTTACGCTCTTCTACTCGGAGCTGTTCACCACGTTCGGCGACATAGCCGCCAACATAACCATGGCCGTGATGCTGATTG
        TGGGCACCATTATCACGGCCATCACCCAGTCGGATCTGAGGCGCCAGAACGCCCAGGTGCCGGCCAGCGGACAGGCTGGC
        AATCCATAGGAAACTCAGGCCGGCACGGCGACCGTCTTTTATGTATAGTATTCCACGCATATCGTTTTACTATTTAATTT
        ATTTAGTTGTTTACTGTACATTCCGTTGTAGCCTTAAGTGTTGAATTTTAAACTGTTCATTAAAGGTGCATAGCAACATA
        CACACGAACACGACACGCACACAACATGCGAATACAAACACGAACACGAATATGAATATGAGTAAGCTTAGGCAATTATT
        TTTTCAATTTTATATTGGCCACCGATTACGGTTTAGTGCTTAGGTTAGATGAATCCAAATTCAGCAGCCCCGAGACTTGC
        ATCGAAATTCAGCTTTATCTTTGCGTTGCCACTGCACTGCAACACCAACTAACACAGGCAAGCCACACAGTACAGACAAG
        ACAAGACAAGTCCTGACAAGACTAGTCAAGACAAGACATGTTACGTATATGGAAATATGCCCAGTATTATAGCCCTAATA
        TTCTAGCGAACGTTGACAGTTTGATTGCTAAGCGGAGTATCCAAAGCAGTTTGAGGCAGTGTATCCGAATCCAGCGAATG
        CCGAATTACCAAACAGTAGCTACGCTGCTCTCGCCTTCGATTGATGTTCCCCCCTCCTTCCGCCTTCTGCAACAGAGAGT
        GTACATAATTTATATACATATATAATTGCATTCCAAACCCGATCCACCGAGGGCGCTGCTACTGTTGTACAAAGCACAAG
        TATATCCTGCATATCTGGCAAACTGTAATATTTTGGATGTTGATTTACAACTAACAGCAGATTCAAGTCAAAATATATAC
        ATACATATATACCT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0088949
        2485
        FBtr0088950
        2699
        FBtr0303287
        3094
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0088022
        482
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0088023
        482
        FBpp0088024
        482
        FBpp0292379
        482
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        Unconventional splice site invoked (GC-CA, ambiguous due to 11-bp duplication); sequence altered due to transposon insertion; this splice may not occur in vivo.

        transcript_exception: non_canonical_splice_site (invoked due to sequence_alteration)

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        CG1358-RA
        Secondary FlyBase IDs
          References (2)