Open Close
General Information
Symbol
Dmel\CG12866-RC
Species
D. melanogaster
Annotation Symbol
CG12866-RC
FlyBase ID
FBtr0300765
Feature type
Associated gene
Evidence Rank
Length (nt)
2809
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 2 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        TCTGTTCGCCCAGCAAAGCACTCAACTCGACCAAATCCCTCTGTTTTTCAGCTTCCCCAGCAGCCAATATGAAGATAAGA
        CCGCCGCTGCACAGCCAAGTGGAAGTAGCTTGAGATCCCAATCTCTGTCCAGGCTGGACATCTCGGTTCAAAACTCATCC
        ATCTATTACAATGATACGCGAAACACGCGACCACAAATGGTCAGTGTGGCCGTCGGCACAGTTTCAACGGATATCCTGAA
        TGGGCGCACATCATTCTTGTCCCTTAGTCAGTCTCACGGGAGTGAAGTGGATTTGCCTTCGTTCTACGAAAGCTTTAATC
        CAACTTTTCTTCCCAAGCTGCCTATCAGAAGATTTCCCCATATGCTTGTGGGGGCATCAAATGAGCCTGAGATTTCGAAA
        AACCAGCCAGCAATTCCACCATCTAGGCCAATTGAGCCAATATCTGAGGTGCCGTTTGTGGAACCGGCCTTTGAGAAAAA
        ATACTCTAGGACCCGTGGATTTAGCAAGGAATTGTCCACACACAGGGATAATGAGAATGAATATATCGAGAGCACAGATG
        AGGTGTCTCAGATGTTGAGCTTTACTAGCTATACGGATGAATATGATAGGGCAGAACCACTCATTACCAAAACGCAAAAG
        TTTTATAAAAAGAGATCCCCCTTGATTCCCAAATACGATTCCGAGGATTCATATGTGGTCCCTAAGGAAACCGATCAACA
        GGAATCGGGTCTCTCGTTCAATGTAACTACAGTACAGTTGGCCGATACCGCATCGCCGGAATCTTTCAGCGAATACGACG
        GAAATCGAACGCGCAAGCAATCGTTCGACATGGAAAGTAAAAATTCGAAGGAGTCCTTTGACTTTAGCCGTGGTGGAAGA
        CGACTTGGCTCCGGTATGGTTTTTATCTATATGGTGATACCACCGGACGGCGGATTCGGTTGGGTAATCATGGTGCTGTC
        CTTCCTCGCCCAGCTGATAATCGATGGTTTAATTTTTACCATTGGGGTCTTATTGCCATCCATTGCCCAGGATCTGGATG
        TCTCCATATCGTCGGTATCGTTTGTGGCCAGTGTCCAGATTGGTTGCTACTTCACTAGCGGAGCGTTTTCTGCTGTCCTG
        ATAAATCGTTTTGGTTTCCGAAAGGTAGCCATCGCTGGGGTCCTGTGTTCCGCAGTTTCAATACTGGCGTCCAGTTGGAG
        CGTCAGCTTGACCATGCTGATCTTCTTTTACAGCGTCCTTGGTGGTATTACGTTGAGCATGATCTGGGCAAGTTCGCAGC
        TGATTGTTGGCTACTACTTTGAGCGGTACCGTCCGATGGCCAATGGATTTTCCTGCAGCGGTGGCGGTGCGGGCATAGTA
        CTCTTCACGTTCCTCAACAGCTGGCTGGTGCCAATCATCGGATGGAGGAACATGCTGCGGACGCAGGCGGGGCTGATAAT
        GTTGATCCTGTTGATGGTGGTCGCCTATGTGGAGGTGGCTCCCACCCAGGTGGGCATGTACCATTTACCCGGTTCTTCGG
        ATACCAGTTCGGATGAGTATTACGGCAACTTCTACGTGCATGACTATTTACGTCAATCCGCGATGACTGCTAAAAGCCGG
        AGTATCCTAAGTACATATGAGCCACGCCCAAAAAAGAAAGGATGCGCCAAGTTCTGCCCCTCCTGTTCGAACTGTTGTTG
        GAGGCGGCGGAAGAAGTCGCAAAATGCTGATGAGCAGAATCTGCTCATCCGCCCGGCGCCCCTGGAGCGGGAGGATCTCT
        TCTATACGGGTCCTGCCGAATACGAAAAGCCGCACAGCAAGGAGAACGTCGACGGCAAGGAGTTCCTACTAATGGGATCG
        GATAAGAACACCCAGCAAGTGAACTATGGCATCAAGAACATTCGTGTGGATGATGAACCCGATAGGATTTCTAGAGTTCA
        TAGGGAACGAAGATGGTCAAACGAGAATCAGAAAAAGCAAAATTCCTGTAGGAATAGCCGGTTTATGCTCACTGTGCTCA
        AACTATTCGACTACCGCCTGCTGAAACAGTTTGAGTTCAAGATTCTGGTGGCGTCCGCCTTTCTGTTCCCGATGGGCTTT
        AATATACCCTTTGTTTACTCGTCTGCACGAACCACGATCCCCGTCGAATATGCCCGTATGATCGGCCCCATTATCGGAAT
        TAGTAATCTTGTGATGAGAAACATCCTTGGCATCCTCGCTTACAAAAGGCGTAGTTGGACCCTCGGACTTTGTGGTTGTG
        GTCTAATTTTCGGTGGTGTTTCCGTTTTGATTAGCGCCTTCTATGGAGAGAACTTGATTTGGTTCCAGTTTCTGTATGGC
        TTCTCCTATGCTGTAGCGCCTGCTGTTTATTCCACACTGAGAGGTTTGATATACGTGAAATACCTGGGACTTTCAAAACT
        GACCAACGCTTTTGGGATTACCTCATTGGCCATGGGAATGGGCGCCTTTATTGGGACTACAATTGCTGGTAAATTGATAG
        GCATCACGGGAAACTATTCTGCTGCCTTTTGCTTTGCGGGATTATGTCTCATAGTGTCCGGATTTCTGAAGCTTCTGCTG
        CCCTTGCTTATTAAATGTCGCAACAGGATGGCCCAATGAGGAATTGGACTATTGGAATTGCAATATTTATTGGTTCTCCT
        GCTTGGAACTTGGGATTGTCTTACAACTAATAGCTTAGGCATTTTTATGACTTTTTTTTACTGGTCCTCGTTCCAAATTC
        TGAGTAAATGTTTGTATATCCATGTAATTGTTAATTGACCGATGTCATTAACTATTACTTCCTCCTTATTACAGATTTAT
        TTTCAATAT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0300764
        2806
        FBtr0339981
        2815
        FBtr0339982
        2810
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0289989
        800
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0289988
        856
        FBpp0309002
        859
        FBpp0309003
        357
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        CG12866-RC
        Secondary FlyBase IDs
          References (0)