Open Close
General Information
Symbol
Dmel\CG12866-RE
Species
D. melanogaster
Annotation Symbol
CG12866-RE
FlyBase ID
FBtr0339982
Feature type
Associated gene
Evidence Rank
Length (nt)
2810
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 1 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          GAACACTCTGCGACAGAGTCGAAAAATGAGCAGGAATCGTAGGCGAAGCTTCCCCAGCAGCCAATATGAAGATAAGACCG
          CCGCTGCACAGCCAAGTGGAAGTAGCTTGAGATCCCAATCTCTGTCCAGGCTGGACATCTCGGTTCAAAACTCATCCATC
          TATTACAATGATACGCGAAACACGCGACCACAAATGGTCAGTGTGGCCGTCGGCACAGTTTCAACGGATATCCTGAATGG
          GCGCACATCATTCTTGTCCCTTAGTCAGTCTCACGGGAGTGAAGTGGATTTGCCTTCGTTCTACGAAAGCTTTAATCCAA
          CTTTTCTTCCCAAGCTGCCTATCAGAAGATTTCCCCATATGCTTGTGGGGGCATCAAATGAGCCTGAGATTTCGAAAAAC
          CAGCCAGCAATTCCACCATCTAGGCCAATTGAGCCAATATCTGAGGTGCCGTTTGTGGAACCGGCCTTTGAGAAAAAATA
          CTCTAGGACCCGTGGATTTAGCAAGGAATTGTCCACACACAGGGATAATGAGAATGAATATATCGAGAGCACAGATGAGG
          TGTCTCAGATGTTGAGCTTTACTAGCTATACGGATGAATATGATAGGGCAGAACCACTCATTACCAAAACGCAAAAGTTT
          TATAAAAAGAGATCCCCCTTGATTCCCAAATACGATTCCGAGGATTCATATGTGGTCCCTAAGGAAACCGATCAACAGGA
          ATCGGGTCTCTCGTTCAATGTAACTACAGTACAGTTGGCCGATACCGCATCGCCGGAATCTTTCAGCGAATACGACGGAA
          ATCGAACGCGCAAGCAATCGTTCGACATGGAAAGTAAAAATTCGAAGGAGTCCTTTGACTTTAGCCGTGGTGGAAGACGA
          CTTGGCTCCGGTATGGTTTTTGTAAATCTATATGGTGATACCACCGGACGGCGGATTCGGTTGGGTAATCATGGTGCTGT
          CCTTCCTCGCCCAGCTGATAATCGATGGTTTAATTTTTACCATTGGGGTCTTATTGCCATCCATTGCCCAGGATCTGGAT
          GTCTCCATATCGTCGGTATCGTTTGTGGCCAGTGTCCAGATTGGTTGCTACTTCACTAGCGGAGCGTTTTCTGCTGTCCT
          GATAAATCGTTTTGGTTTCCGAAAGGTAGCCATCGCTGGGGTCCTGTGTTCCGCAGTTTCAATACTGGCGTCCAGTTGGA
          GCGTCAGCTTGACCATGCTGATCTTCTTTTACAGCGTCCTTGGTGGTATTACGTTGAGCATGATCTGGGCAAGTTCGCAG
          CTGATTGTTGGCTACTACTTTGAGCGGTACCGTCCGATGGCCAATGGATTTTCCTGCAGCGGTGGCGGTGCGGGCATAGT
          ACTCTTCACGTTCCTCAACAGCTGGCTGGTGCCAATCATCGGATGGAGGAACATGCTGCGGACGCAGGCGGGGCTGATAA
          TGTTGATCCTGTTGATGGTGGTCGCCTATGTGGAGGTGGCTCCCACCCAGGTGGGCATGTACCATTTACCCGGTTCTTCG
          GATACCAGTTCGGATGAGTATTACGGCAACTTCTACGTGCATGACTATTTACGTCAATCCGCGATGACTGCTAAAAGCCG
          GAGTATCCTAAGTACATATGAGCCACGCCCAAAAAAGAAAGGATGCGCCAAGTTCTGCCCCTCCTGTTCGAACTGTTGTT
          GGAGGCGGCGGAAGAAGTCGCAAAATGCTGATGAGCAGAATCTGCTCATCCGCCCGGCGCCCCTGGAGCGGGAGGATCTC
          TTCTATACGGGTCCTGCCGAATACGAAAAGCCGCACAGCAAGGAGAACGTCGACGGCAAGGAGTTCCTACTAATGGGATC
          GGATAAGAACACCCAGCAAGTGAACTATGGCATCAAGAACATTCGTGTGGATGATGAACCCGATAGGATTTCTAGAGTTC
          ATAGGGAACGAAGATGGTCAAACGAGAATCAGAAAAAGCAAAATTCCTGTAGGAATAGCCGGTTTATGCTCACTGTGCTC
          AAACTATTCGACTACCGCCTGCTGAAACAGTTTGAGTTCAAGATTCTGGTGGCGTCCGCCTTTCTGTTCCCGATGGGCTT
          TAATATACCCTTTGTTTACTCGTCTGCACGAACCACGATCCCCGTCGAATATGCCCGTATGATCGGCCCCATTATCGGAA
          TTAGTAATCTTGTGATGAGAAACATCCTTGGCATCCTCGCTTACAAAAGGCGTAGTTGGACCCTCGGACTTTGTGGTTGT
          GGTCTAATTTTCGGTGGTGTTTCCGTTTTGATTAGCGCCTTCTATGGAGAGAACTTGATTTGGTTCCAGTTTCTGTATGG
          CTTCTCCTATGCTGTAGCGCCTGCTGTTTATTCCACACTGAGAGGTTTGATATACGTGAAATACCTGGGACTTTCAAAAC
          TGACCAACGCTTTTGGGATTACCTCATTGGCCATGGGAATGGGCGCCTTTATTGGGACTACAATTGCTGGTAAATTGATA
          GGCATCACGGGAAACTATTCTGCTGCCTTTTGCTTTGCGGGATTATGTCTCATAGTGTCCGGATTTCTGAAGCTTCTGCT
          GCCCTTGCTTATTAAATGTCGCAACAGGATGGCCCAATGAGGAATTGGACTATTGGAATTGCAATATTTATTGGTTCTCC
          TGCTTGGAACTTGGGATTGTCTTACAACTAATAGCTTAGGCATTTTTATGACTTTTTTTTACTGGTCCTCGTTCCAAATT
          CTGAGTAAATGTTTGTATATCCATGTAATTGTTAATTGACCGATGTCATTAACTATTACTTCCTCCTTATTACAGATTTA
          TTTTCAATAT
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0300764
          2806
          FBtr0300765
          2809
          FBtr0339981
          2815
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0309003
          357
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0289988
          856
          FBpp0289989
          800
          FBpp0309002
          859
          Comments

          Evidence supports alternative splice leading to premature stop codon and/or downstream start; may or may not produce functional polypeptide.

          Transcript terminates at site supported by polyadenylated cDNA.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          CG12866-RE
          Secondary FlyBase IDs
            References (0)