Open Close
General Information
Symbol
Dmel\AGO1-RD
Species
D. melanogaster
Annotation Symbol
CG6671-RD
FlyBase ID
FBtr0305592
Feature type
Associated gene
Evidence Rank
Length (nt)
7888
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 188 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      CAAATAAGTTGTGTTTGTGCAAAACTCGCGCGTTCGCAATTTTCCGAAGCTGACTCTCAATTCTCATACATAACGATCTC
      AAGCGATCTCCGCCAGGCGAATCAAACCCGGATATATCCAGATCTGCACGCTGGAAAAGTAACGTCCGCAACGGTTTAAA
      TCCAGTCGAGACGCAAACCCCACTCAACTCCTTAATGAGTTCCCCTCCATTAAACGGAATTCACCAAAAAAAACGATTGA
      TTTGCCGCTGATAAAGCTGATAAAAGCGCACACACACACCAAAGTCAGCTGCAATTTTGCGATAAGGAGCAGCGACGCCG
      CCTCAAACTGACGCCGACACCGACTAAAATGTCCACGGAGCGTGAGCTGGCTCCCGGTGGGCCAGCTCAGCTCCATCCGC
      ACACGCTGCCGCTGACTTTTCCGGATCTCCAGATGACCTCCACCGTGGGCATCATTGGGAAAGTCTACGAGTCACAGTGG
      ACCCCCTCGCCCACTCGGCCTCAGAGTCCCTCTCAGGCGCAGACTAGCTTCGACACGCTCACATCACCACCAGCGCCCGG
      CTCGTCGGTCAATCCCACCGCCGTCACCAGCCCAAGTGCCCAGAATGTGGCCGCTGGTGGAGCAACTGTGGCCGGTGCAG
      CAGCAACTGCCGCCCAGGTGGCCTCCGCCTTGGGTGCCACCACCGGCAGCGTGACGCCAGCAATTGCCACCGCAACGCCA
      GCCACGCAGCCGGATATGCCCGTCTTTACGTGTCCACGACGCCCGAATCTCGGACGAGAGGGTCGCCCGATTGTGCTGCG
      CGCCAATCACTTCCAGGTGACAATGCCGCGTGGCTATGTGCATCACTATGACATCAATATACAGCCGGACAAGTGTCCGC
      GAAAGGTGAACCGTGAGATTATCGAGACTATGGTGCATGCCTATAGCAAGATCTTCGGAGTGCTCAAGCCGGTGTTCGAT
      GGTCGCAACAATCTGTATACCCGCGATCCCCTGCCCATTGGCAACGAGCGTCTAGAGCTGGAGGTTACTCTACCCGGCGA
      GGGCAAAGATCGAATCTTTCGCGTGACGATCAAGTGGCAGGCTCAGGTCTCGCTCTTCAATTTGGAGGAAGCTCTCGAAG
      GCCGCACGCGGCAGATACCCTATGATGCCATTTTGGCGCTCGATGTGGTCATGCGCCATCTGCCCAGCATGACGTACACG
      CCAGTGGGACGTAGCTTCTTCAGTTCCCCGGAGGGTTACTACCATCCCCTGGGTGGTGGACGCGAGGTTTGGTTCGGTTT
      CCATCAGAGCGTAAGGCCCTCGCAGTGGAAGATGATGCTCAATATCGATGTCTCGGCCACCGCTTTCTACAAGGCTCAAC
      CAGTCATTGACTTCATGTGCGAGGTGCTGGACATTCGCGACATCAACGAGCAGCGCAAACCGCTCACCGATTCGCAGCGC
      GTCAAGTTCACGAAGGAGATCAAGGGTTTGAAGATCGAGATCACCCACTGCGGCCAGATGCGTCGCAAGTATCGTGTGTG
      CAACGTCACTCGCCGCCCCGCTCAGATGCAATCATTCCCACTGCAGCTGGAGAACGGACAGACCGTAGAGTGCACCGTGG
      CCAAGTACTTCCTGGACAAGTACCGCATGAAATTGCGCTACCCGCACTTGCCCTGCCTGCAGGTTGGCCAAGAGCACAAG
      CACACTTACCTGCCTCTAGAGGTGTGCAACATTGTGGCCGGACAGCGGTGCATTAAAAAGCTGACCGATATGCAGACGTC
      GACCATGATCAAGGCCACAGCTCGTTCAGCTCCGGATCGTGAGCGTGAGATTAACAACTTGGTAAAGCGCGCCGACTTCA
      ACAACGATTCGTATGTGCAAGAGTTTGGCCTGACCATCTCCAATTCGATGATGGAGGTACGAGGACGCGTCTTGCCTCCT
      CCCAAGCTTCAGTATGGGGGACGTGTGTCTACCGGCCTCACCGGCCAGCAGCTGTTCCCGCCACAGAACAAGGTGAGCTT
      GGCCTCGCCCAACCAGGGTGTATGGGATATGCGAGGCAAGCAGTTCTTCACTGGCGTCGAGATCCGCATCTGGGCCATCG
      CCTGTTTTGCCCCACAGCGCACGGTGCGCGAGGATGCGCTGCGTAATTTCACCCAGCAGCTGCAGAAGATCTCAAACGAT
      GCAGGCATGCCGATAATTGGACAGCCGTGCTTCTGTAAGTACGCCACCGGGCCGGATCAAGTGGAACCCATGTTCCGTTA
      CCTGAAGATCACCTTCCCCGGCCTGCAACTCGTCGTGGTTGTGCTGCCCGGCAAGACTCCAGTATACGCCGAGGTGAAGC
      GTGTAGGTGACACCGTTCTGGGTATGGCCACCCAGTGTGTGCAGGCCAAGAACGTGAACAAGACATCGCCACAGACGCTC
      TCTAATCTGTGTCTGAAGATCAACGTCAAGTTGGGCGGCATCAATTCAATTCTGGTCCCCTCCATTCGGCCAAAGGTCTT
      CAATGAGCCGGTCATCTTTTTGGGTGCCGATGTGACACACCCACCAGCTGGCGACAACAAGAAACCATCGATTGCCGCCG
      TCGTGGGCTCCATGGATGCCCATCCATCGCGGTATGCCGCCACCGTTCGCGTACAGCAGCACCGACAGGAGATCATCCAG
      GAGCTGAGCAGCATGGTGCGCGAGCTGTTGATCATGTTCTACAAGTCGACGGGCGGCTACAAGCCCCACCGCATCATACT
      CTATCGTGACGGAGTCTCCGAGGGACAATTCCCACATGTCCTGCAACACGAATTGACCGCCATTCGCGAGGCCTGCATTA
      AGCTAGAGCCAGAGTATCGGCCGGGCATCACATTCATTGTGGTGCAGAAGCGCCATCACACTCGACTCTTCTGCGCGGAG
      AAGAAGGAGCAGAGCGGCAAATCGGGCAATATTCCCGCAGGCACCACCGTCGATGTGGGCATCACACATCCCACCGAATT
      TGATTTCTATCTATGCAGCCATCAGGGCATCCAGGGCACCAGTCGCCCCTCGCACTACCACGTTCTGTGGGACGACAATC
      ACTTTGACTCGGACGAGCTGCAGTGCCTCACGTATCAGCTATGCCATACGTACGTGCGCTGCACCCGATCCGTCAGTATA
      CCGGCGCCAGCCTACTACGCCCATTTAGTGGCCTTCCGTGCCAGATATCATCTGGTGGAGAAGGAGCACGATTCGGGCGA
      GGGTTCGCACCAGAGCGGCTGCTCAGAGGATCGTACGCCAGGTGCCATGGCCAGGGCCATCACTGTGCACGCGGATACCA
      AGAAGGTCATGTACTTTGCCTAAAAAGTATCGCCCCTCCCCAATACCAACACCAAAAAGCTAAAGAATACAAAATCAGTT
      TCGAATTTCGATTCGAATAAGCAACTCCCCACTTCCTTCCCTCAAATCAGAAAGCGGAAAGCGGATGAAAGCCAAGCATA
      GAAGTTTAGAATTAAGTTACGTTTTACGTTGAGAGAGCGCGGATGGGTGGAAAAACCAATCAGAATACGAAGATCTTGCA
      TGCATTAGTTACGTACACGTACATATATAGTAAGCAGAGTAATGAAAATCCCACAAACACCATCCACACACTCACTCATC
      CACACACACACAAATCAGATAGCCACACAGTGAGAAATGATAACTAATCGAATGTCAGGCACAAGTTTGCGAAATCAAAG
      AAATGTGAGAATTCTCAAAAACAAGCGTAGCAAACAAATTGAAAGCAAATAGGAAATCAACTAAAGGGAACAAAAACTAC
      GACAGCAACACCAACCAACACCAGAAAAACAAAACAAATTAAAACATAACCAAAATGGAAGTGAAATTACGTGAAAAGCG
      AGCGTCATCAGCACGAGAGAGAGAGACAAGTTTTGTAATAGAAATTACGATTAAATTGTACAATATATTTTTACACGATA
      CGAAATGAAGACATGATGAATGATAATGAATGAATGCATACAACCAAAGGTTTTTAGTATACAAAATGAATACGTTGCTG
      ATCGACTCACACAGCAAACACCACATGAACACCAACCACTCGGATTCTCTGTACTGTGAACGAAGACCACCACCAAAATA
      TAAACAAAAACCACAAGCGACATTAAAGCGACAAGCATTGAAAGAGTGTGTAGACACAACTTAGCATGTACTAATGAATT
      ACTTCAATACTTCAACTAGGGCGCTGACAAAACCAAGCAAGAACATTTAATAGTTTGTAAGTTGGGCTCTACCAAAAACC
      GAACACAAAATGAGAGAGAGAGAGAGAGAGAAAAATGCAAGCAAGGCCAGATAAGTTAAGTGGGCAATGAATAACGAGAA
      CTGCAATTTCAACAAGGGACAAACTTTTGGTCAAAACAATAGCTATACTTATAGAGCAGAGCCTAATATATACATACATA
      ATTAGAATCTAAAACTAAAATTTAAAGTTTTTACGAAACGATAACCAAGCGGATGGAGCTGTTGTAACAATGTAGATTAC
      TTAAATTCAAAAGTGCAAATAACACGGTAGCAGACACGTTACGTTGGCAGTGCTGATATTTTATGTTAGTCCTTAGTTTA
      CCCTCTTTTATGCACCACACCACCACACAATCAGACTCCGAACTTCTTCAACCCTCCTCGAGTCCAAGGCATATCACTCA
      ATGTCCTCTTATTTATGTACCTCCTACAATAAGCCTTATGATATATTTAGTTGTACCTTATATATATATATATATATTTT
      TTAAAACGAATGCCTAACGAAATTTGTTGATTTCTTCATGTTGATGCTTCGAATTGGCTTCTTCGCTGCTTTTCGTTGTA
      ATAATTTCGTATTAATTAACTTTAGATCAAAGTGGTGTACGGGTAATAATAAACAAGGTAACTCTTCTCCACCGTCCGCC
      GGAGGGAGGTGGCAACAACATTTCAATATTTTACAAAGTAGTTTTAGTTTCGCCAAAATCAACAAGCAAACAAACAATAT
      CAATATCAATATGAAACGTATGCTTAGTAATTGTACTATATCGAGGACACAGTTCAAGTTAACATTATAATGAGTTGTTA
      TTTATGCGGCGCGGGCGACGACGTTCTATCCACTCGGAATCGCCCGGGCCAAACCTAATTTATAATTGTATACATCCTTC
      TTCACAGAACCTTTAATTTAGATTTAGTTTCCAAGTTTGCAAGCTGTTTTGCCAATCGTACATTATGTGAGCATTATAAA
      ATACATAATATATATAAATCTATATGCTTATATTTAATCATTTACTGCACTTACAAATTAGTTGGTAATCCTCAAGAATA
      TATGTATAAAGAAAAAAAGGGAACAGAACGGAAGAAAGGAGGTCGCACGCGGTCCCTCAAAATGTTGAATCGAACTTATA
      GAAATCTCTTTGGATTTGAAATCATATACAAACTGGTGGAACTTCACGAATGATTTCAAATCCCTTGATATTTCAGTGGT
      GGCAAAAAATTTTTAAATCTGCATTCTCAATGCCTGTTTTTAAACTTCTCGATGTTTATCATTTAGTCAACTACTTCGAG
      TGCAATGATATCTTTTGCAGAAATTTTAAAACCAGAGTTAATATTTAAAAGTCTTCAAATAAAGTTTTTTTTTTGTCTAA
      ATTTTGACTAGTCCTTCCAACGAGGCTCAACATAGCTGATATTAATAGCTTATTAATTAATTAATATTAATTGGTAATGC
      GTTTAAATGCGATTAACATTTTGTGGGGCTGTGCAATTAATTGTGTGGGCGTATTTGTGGACTTATTCATTTTCCATTTT
      TTTTTCTAATAACGTTTCTACACAAGGGATTAAAATTTTAAACTTATGTCTTAATTTTTACTTAAAGCAACCCGATGCAA
      AAAAAAACAAACAAACAAAAACCAACAAAAAAACGAATCAAACAATTTTAGTTTTAAGAAAAAAAAAAACAAGAAAACGA
      AAACGAAACAATGCAAAGGAGTTCGCGATTCGGGGCTCGATTTTTGAGATCGGCCAGAAAGAACCAACATTTACATTATA
      TATTCACTTAGTTTAAGCTGAAGCTGAAATGTGTGCCGACAATGAATGCATCTCGTAGTTGTAAAATGAGCGAAATATTC
      AACAATAATTTACTTTACCACACAATACATGAGAAAGTCCAAAGCTTTAACTTACTCGCAAGATGAATGAAGCGGAAATA
      TCGGTGGGAAAACCCTTATCACTAATGAAAATGCCAATAACAAGCTGCTATCTCCTCCCATCCAAGAAAAATGGGCTGTA
      ACAGTTGTCCCTATATACACGCGTAAAACTTATACATATATAGTAAAGCTGGATAACTCCGATTTTCCCAAGAACTCAAG
      AAAACTACTCACACACGCTACAATTTCAATGGTTTCTTCAGTGTCGTGCAGCTAAGTAAAAGGAAAACAAGTTGGAGGAG
      AAGATTGAAGATCGTGGATGGCCTTAGATATCATTTCCAAACTATGTTCTGCTCAGAGGCAAGGCCCAAATAAAAAGACA
      AAAAGCCGGGATATCCAAATGGGAACTTACATTTTTATCTGTCAAAATTCAATTGAGCTTTAAACTAAAGATAGATCGAG
      AAAAAACGAAAATAAAAAAAAAACAAAAAAAAAATGGAAGTAAAAACTTGAACAAAAAAAAGAAGAGAAGAGTAAGAAAT
      ACAGAAAGGAATCGCATTGTTTCTACATATTACTTATAAATGTGCCGTTTATAGATGTCTACAATTATATACAACAAATA
      TAGATATATACCTAGATATATAATCAGATCGAAATCGAAGCTAGAACAGCAATTTGCACAACTCTTCCTAAAGGAAATAA
      AAAGATAAAAATACAAATCTAAATCTAACTAACGATTAAATTACATATATGCCACAATTACCGAGATTTCAAGAAGTGAC
      GGACTAACTCCAAGCAATTAAAACGTTATATTTGAAATAACTTATGAACTTATGATACCATATATGTATGTGTGTACTCT
      ATACTCTTCCAACTAGACCCAGAGTCCCACTCGAACCCGGACCACATGCGCGATCCACATAGCCATTAGCCCACAAACAC
      TCAATCCACACAATACACACAATCCACACTCGACTTAGTGTTCCAAATGCGCATCGGATCAGATCGGATAACGAACCCCT
      TAGCTGAAATTCGACTAGCAAAATCAATACGTTAGTAACACTTATTCGTGCGTTAAGATTAGGGAGATCATCTGGTACAT
      ACCTTACTTTAAAAATCAACCAAAATGCCGGGTAATTAATCAATAAAATACATATTATTAGTTCTAATCTAAGAGGAGTA
      AACAAAAACAAAACAAAAACAAAAGGAAAACAAAAATACATCAACATTATGAATAAAGAAAAATAAGCAACGTGAGCAAC
      GTAATATGGGAAATCTGTAACTTTGGTGATCTTTTTAAATGTTATTAGTAAAAGAAGGCAAAACAAAATCAAGTTTAATG
      ACGAATACAAATCAAACCAGTTTTAAATGTGACTTAAATTACGACGTAAACGACATTTTTCCACAACATTATATGTGTAA
      ACAAGACGAAAAACAAAACAAAAAATGCAAAATGCGAGTTTGTGAAATATGCAATTTAATGAAAGTTGATGATCTTTTCG
      ATATAATTCTGTCAAGCTGTCTTAACAATTAGTTATAAGCGCTTCAATACAAGAAACCATCAAACAAAAATCAACAAACT
      CAATTAAGTTATGGAAAACACAATTATATATAACAACAAATCGTATATGTTTTATACAAATTGTAATTATTTTTATCGAT
      TTCGATTTGATTTTTTAAACCCACGAAATGTACCCATCCCTTGTAAAACAAAAACGATTTTAGTTTGCGTTTAAAATAAG
      AAAACAGCATATACAATTCATTTTTGTTCAATAAAAATATATTTAACT
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0087613
      3481
      FBtr0087614
      5738
      FBtr0087612
      7528
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0294043
      984
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0086739
      984
      FBpp0086740
      950
      FBpp0086738
      984
      Comments

      Extended 3' UTR supported by EST and RNA-Seq data.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (1)
      Reported As
      Symbol Synonym
      AGO1-RD
      Secondary FlyBase IDs
        References (0)