Open Close
General Information
Symbol
Dmel\CG6006-RE
Species
D. melanogaster
Annotation Symbol
CG6006-RE
FlyBase ID
FBtr0309302
Feature type
Associated gene
Evidence Rank
Length (nt)
3739
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 16 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          GATGAACTTGAACGCCGCAACAGCCGCCCTTTGCCGTCGCCAGTCGAATCGCATTTTCAGCATCAGCGCCTAGCAAATAG
          TGCGAATCAAGAGCAGGAAGCGTTGTTGTTGCCGCCAGCAGCCAAAAGACAAGCGGTACGAGTGCGAGACCGTAGGGCCG
          TAGACGCTCGTAAAATCAGACAGCATTTTACGTGTCAGTTTCCGTTTAGTGCGCCTCTAGCCGTAAATTTATTCCAAAAG
          TGAGAAAAAATAAAAAAAAAAAGAAAATAAAAAAACGACGAGCGTGCGACGGATTTCCGCGCCAAGACAGACAGACACAC
          ACCATCAAAACAAAAAGAGCCAGCCACAGGAAACGGGCTAGGAAGTCGCCATCAGCCCTGCCAATTGTGCAGCAGGACGC
          TTGCTGCAGGATTGGCTGCGCCCGAACCTGCGACACCAGCAGCAACATCAGCAGCAGCAACACCCGCAGCAACTTGTTTT
          GTCTATCCATAAGTTCCTTTGTGCATCATGCACGACTCCGCCAAACAATCCCCCACCACCAGCCCCACCATCCCTCCCAA
          ACAGCAGGCAGCGACGCCTCAGTCGCCAGCAGCGGCGGTGAGCGGACTGGATCCGGCGGACGATGAGGACGAGACCGACG
          TGATCGGCGACCTGATGGGACACTACGGCAAGTGGCAGTTGCTGATGACGGTGCTGCTGTCGCTCTTCCAGGTGCCCAAC
          ACCTTCCACATATCCTCGTCCATCTACCAGGCGGCCAACAAGGACTTTTGGTGCCAGCGACCAGCGCAACTCCAGCACAT
          GCCAGTGGCCACCTGGCGAAACTTAAGTGGCTCCGTCGACAACTGCCGGCGATGGGAGGGCATCGATTGGAGTCAAGTGA
          GCAATGAAACCACGCTGCCATCAGACTGGAAGACACCAGCGGAGATGGATAAAAAGTTGGTGGCCTGCGAGAAATGGGAG
          TACGAGACGAACGACAATGTCGGCAACACCTGGACATCGCAGTGGGATCTGGTCTGCGAGAAGGAGCACCTAAAGAACGT
          GGCCGAGATGTTCTTCCTTCTGGGCGTGGCAACAGGTGGCATTATCTCCGGCTATTTATCGGACAAGTTCGGCCGCAAGA
          CAATGCTTTTCATATCGGCCGTGCTGCAGACCATATTCGGTCTTTGGCTCTATATCTGCAGCTCCTTTGAGCTTTATCTC
          ACACTTCGCGCTCTGCTTGGTCTGGTATCGGTATCGGTCACCTACTCCGGTCTAATCCTAGCCATTGAGTATGTGGATGG
          CAAATGGAGAACCATCGCCGGAATGTACAACCTGTTTCCACTGCCAATCTCTTACATGATCATCTCGGGCCTGGCCTATC
          TGACCCAGGACTATCAACGCCTACAGCTGTGCATCGGCATTCCGGGAATCTTCCTGTGCTTTCTTTGGTTTGTGGTGCCG
          GAATCGCCGCGCTGGCTGCTGGTCAAGGGTCGAATCGATGAAGTGCGTCGAATTATTGAGGCGGCCGCAAAGTTCAATGG
          TCGCCAGCTGCCCGCCGATTATCAACTGACGCCGCCGACGCAGGAGAGCAGTACGCAGGACGTTACCTACCTGTTCCGCT
          CCAGTTACCTGCGTCGCATCTCCATTTGCTTCTTTTGCATCTGGTTCACCATGAATCTGGTATACTACGGCATTATTCTT
          AACATGAGCTCCTTTGGCGGCAATGTCTACTTGAATTCGGCGCTAGCTGGCCTAGTCGAAATACCCGCCATCGCCGTGGC
          CATGTACATCATCACCAAAGTGGGCAAGAAGTGGCTCTTTTGCGCCACTTTGATCTGTGCCGGCGTCGCCTGCTGCTGTG
          CGGCGATCACCGAGGGGCATGCGGATCTGCTCTGGCTGAAGATCACATTCCTGATGATGGGCAAGTTCACCATTAGTGCT
          GGCAATACCATAATGCCGGTGTACACGGCGGAACTGTATCCCACGCCCATACGCAATGTGGGCGTGGGTGCCTGCAATGT
          GGCCGCCGGTTTGGCCTTGATCCTCACACCATACCTGTCGCTACTGGTGAGTTTACCTCTTAACAAGATCGAGGGCCATC
          TCTTGATGACTCTGCTCACCGCCTGGAGCATCTTTGGCGGCTTTGTGGTGCTCTTCCTGCCCGAAACCGCTGTGCGTCAG
          AAGACAGACAACCAGGGTGGCTCAAGTGCCAATGCCAGTGCCGCCAAGCAGGTGTAATGACCGCCATTGCCAATCCTAAC
          CTGCTCAGCCCACGAGGAACAAAGTATTTTGGCTGGTCCAAAGTATGCCGATTAGAAGTCAGCGTATCCAACGCAGTTGC
          TGTCTCTCTGCCCCCCACTTAACCCCCAATCTGCCACGCCACCCGACATATCCACCGCCTGAAGCCACCTAAAATGTATG
          GTAACGATTCGATGAATGTCCAAAAGTAATGCCAATTCGCTGGAGAACGTCACATGTCAGGCAGGACCTTGTTTGCGTAG
          CACGTAATGAGTATGTATCTTACTAACTAACAACAATGGCTTGTAGCTTATGTCATAATCTAAGTACTGAAAACACACAG
          AACACCCAGAATGTTACCAAAAACACTCGAAGTAGCTTAAGTTCTTCGGTTCCCATCGAAGGTTATAAATTTGACCCAAG
          TTTAGGGAGGGTTTGCAATGGGAGCTTACAAACTTATTTTAATACAGCTTTATTATATTATTTTATAATTTTATTTAAAT
          GGTTTTAAAAATAAGGAAGTATTTTTTTGTACGTGATTGCGCCACAAGCTCCCTAGGAAGAGTAATAAAAATAAAAAATT
          ACCCAGTAAATACAGAGCGCTTAATTACGGAATTACCAATTCAATTACAAACGAATTAAAGTTCACACAAAGAAAATTTT
          AGAAAAACAATTTATAATGTTGTCAATATGTCTTGTCAATATCTCAACGTATGCATAATCTCGTCGTCGTCGTCGTCGTC
          TTCTTGTTGTCTATTAATAAATGTTTTCCAAATACGAGATGAATAAGCAGAGAAGCTCAATCTTCCACAGAAAAGAGAAA
          TGAGAATGGCAGATTTAAGCGACCATTTGTAATCTCTAGTAATCGTAGTCAATTAATCCTTAGTCTACCCTTAAACGTAT
          CTACAACAGATCAGTCTCTAAGTATCGGTCAATTATGGATTTGTATATATTGTCTGTTTGTGTGTGGAGGAGACACAGGA
          CATACAAGGAGTTTTACTGTTTGGAGCCATCAAAGAATATATGTATATGAAATGAACAAATAAATTTCCAATATAATGCA
          TTTAACAATGTATACAATTATGTGTATATGGATATGTGTGCGTTTGTGTATGTATATGTAGAGAAAAACAAAAACAATCA
          AATTAGAGAAAGCCAACCTGTTGAATTACTTGTTGTACTTACCTATCAAGTTGTTATGTGCTCATTTGTATTTTGTATTA
          TTTTCCGCAATATAATGTCGCTTATTTTACATTTATTTTTGTTGCCTATTGTACTTACCCGCTAAGATCATATCAGCTTT
          GTTATGTACTATTTGTCATTAGTAAGAGATTTCATTAAGCTTCAAACAAACGGAATACCCGAATCTAAAACAACATTAAA
          TTAATTGTTAAGTTAAAGTGTTTGAGCGAAACACAGACATAAATTTATGAAAATTGTTGTAAATCAAAATTACCAAAGCA
          AACGCAATTATAGTGTCAAAATAAAACATAAATAAATAAATAAATAAATAAATTAAAAC
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0083252
          2772
          FBtr0113477
          3869
          FBtr0309301
          2790
          FBtr0309303
          2716
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0301217
          569
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0082706
          569
          FBpp0112387
          603
          FBpp0301216
          569
          FBpp0301218
          569
          Comments

          Transcript terminates at site supported by polyadenylated cDNA.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          CG6006-RE
          Secondary FlyBase IDs
            References (0)