Open Close
General Information
Symbol
Dmel\CG6006-RF
Species
D. melanogaster
Annotation Symbol
CG6006-RF
FlyBase ID
FBtr0309303
Feature type
Associated gene
Evidence Rank
Length (nt)
2716
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 10 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        GATGAACTTGAACGCCGCAACAGCCGCCCTTTGCCGTCGCCAGTCGAATCGCATTTTCAGCATCAGCGCCTAGCAAATAA
        GACCGTAGGGCCGTAGACGCTCGTAAAATCAGACAGCATTTTACGTGTCAGTTTCCGTTTAGTGCGCCTCTAGCCGTAAA
        TTTATTCCAAAAGTGAGAAAAAATAAAAAAAAAAAGAAAATAAAAAAACGACGAGCGTGCGACGGATTTCCGCGCCAAGA
        CAGACAGACACACACCATCAAAACAAAAAGAGCCAGCCACAGGAAACGGGCTAGGAAGTCGCCATCAGCCCTGCCAATTG
        TGCAGCAGGACGCTTGCTGCAGGATTGGCTGCGCCCGAACCTGCGACACCAGCAGCAACATCAGCAGCAGCAACACCCGC
        AGCAACTTGTTTTGTCTATCCATAAGTTCCTTTGTGCATCATGCACGACTCCGCCAAACAATCCCCCACCACCAGCCCCA
        CCATCCCTCCCAAACAGCAGGCAGCGACGCCTCAGTCGCCAGCAGCGGCGGTGAGCGGACTGGATCCGGCGGACGATGAG
        GACGAGACCGACGTGATCGGCGACCTGATGGGACACTACGGCAAGTGGCAGTTGCTGATGACGGTGCTGCTGTCGCTCTT
        CCAGGTGCCCAACACCTTCCACATATCCTCGTCCATCTACCAGGCGGCCAACAAGGACTTTTGGTGCCAGCGACCAGCGC
        AACTCCAGCACATGCCAGTGGCCACCTGGCGAAACTTAAGTGGCTCCGTCGACAACTGCCGGCGATGGGAGGGCATCGAT
        TGGAGTCAAGTGAGCAATGAAACCACGCTGCCATCAGACTGGAAGACACCAGCGGAGATGGATAAAAAGTTGGTGGCCTG
        CGAGAAATGGGAGTACGAGACGAACGACAATGTCGGCAACACCTGGACATCGCAGTGGGATCTGGTCTGCGAGAAGGAGC
        ACCTAAAGAACGTGGCCGAGATGTTCTTCCTTCTGGGCGTGGCAACAGGTGGCATTATCTCCGGCTATTTATCGGACAAG
        TTCGGCCGCAAGACAATGCTTTTCATATCGGCCGTGCTGCAGACCATATTCGGTCTTTGGCTCTATATCTGCAGCTCCTT
        TGAGCTTTATCTCACACTTCGCGCTCTGCTTGGTCTGGTATCGGTATCGGTCACCTACTCCGGTCTAATCCTAGCCATTG
        AGTATGTGGATGGCAAATGGAGAACCATCGCCGGAATGTACAACCTGTTTCCACTGCCAATCTCTTACATGATCATCTCG
        GGCCTGGCCTATCTGACCCAGGACTATCAACGCCTACAGCTGTGCATCGGCATTCCGGGAATCTTCCTGTGCTTTCTTTG
        GTTTGTGGTGCCGGAATCGCCGCGCTGGCTGCTGGTCAAGGGTCGAATCGATGAAGTGCGTCGAATTATTGAGGCGGCCG
        CAAAGTTCAATGGTCGCCAGCTGCCCGCCGATTATCAACTGACGCCGCCGACGCAGGAGAGCAGTACGCAGGACGTTACC
        TACCTGTTCCGCTCCAGTTACCTGCGTCGCATCTCCATTTGCTTCTTTTGCATCTGGTTCACCATGAATCTGGTATACTA
        CGGCATTATTCTTAACATGAGCTCCTTTGGCGGCAATGTCTACTTGAATTCGGCGCTAGCTGGCCTAGTCGAAATACCCG
        CCATCGCCGTGGCCATGTACATCATCACCAAAGTGGGCAAGAAGTGGCTCTTTTGCGCCACTTTGATCTGTGCCGGCGTC
        GCCTGCTGCTGTGCGGCGATCACCGAGGGGCATGCGGATCTGCTCTGGCTGAAGATCACATTCCTGATGATGGGCAAGTT
        CACCATTAGTGCTGGCAATACCATAATGCCGGTGTACACGGCGGAACTGTATCCCACGCCCATACGCAATGTGGGCGTGG
        GTGCCTGCAATGTGGCCGCCGGTTTGGCCTTGATCCTCACACCATACCTGTCGCTACTGGTGAGTTTACCTCTTAACAAG
        ATCGAGGGCCATCTCTTGATGACTCTGCTCACCGCCTGGAGCATCTTTGGCGGCTTTGTGGTGCTCTTCCTGCCCGAAAC
        CGCTGTGCGTCAGAAGACAGACAACCAGGGTGGCTCAAGTGCCAATGCCAGTGCCGCCAAGCAGGTGTAATGACCGCCAT
        TGCCAATCCTAACCTGCTCAGCCCACGAGGAACAAAGTATTTTGGCTGGTCCAAAGTATGCCGATTAGAAGTCAGCGTAT
        CCAACGCAGTTGCTGTCTCTCTGCCCCCCACTTAACCCCCAATCTGCCACGCCACCCGACATATCCACCGCCTGAAGCCA
        CCTAAAATGTATGGTAACGATTCGATGAATGTCCAAAAGTAATGCCAATTCGCTGGAGAACGTCACATGTCAGGCAGGAC
        CTTGTTTGCGTAGCACGTAATGAGTATGTATCTTACTAACTAACAACAATGGCTTGTAGCTTATGTCATAATCTAAGTAC
        TGAAAACACACAGAACACCCAGAATGTTACCAAAAACACTCGAAGTAGCTTAAGTTCTTCGGTTCCCATCGAAGGTTATA
        AATTTGACCCAAGTTTAGGGAGGGTTTGCAATGGGAGCTTACAAACTTATTTTAATACAGCTTTATTATATTATTTTATA
        ATTTTATTTAAATGGTTTTAAAAATAAGGAAGTATTTTTTTGTACGTGATTGCGCCACAAGCTCCCTAGGAAGAGT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0083252
        2772
        FBtr0113477
        3869
        FBtr0309301
        2790
        FBtr0309302
        3739
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0301218
        569
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0082706
        569
        FBpp0112387
        603
        FBpp0301216
        569
        FBpp0301217
        569
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        CG6006-RF
        Secondary FlyBase IDs
          References (0)