Open Close
General Information
Symbol
Dmel\Dgk-RJ
Species
D. melanogaster
Annotation Symbol
CG34361-RJ
FlyBase ID
FBtr0330238
Feature type
Associated gene
Evidence Rank
Length (nt)
4214
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 15 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          GCGATCGCATCTGGGAAAAAGAGCTGCAAAGCTCCCCGAAAATCAAGAAACGGTCTTGAGTTCATCAGTAAAAACCCCCG
          AAACAAACCCATATATTTTTGTAGTAAACATAAAAACAAACAAAAAAAAAGAAGCGAAAAACCATAACAAACCATAAAAA
          CTAATGAAAATAAAAAATGCTTTATCTTCGCCCCTTCGCGAAGATATAGCGATATCGCAGGAAAACACCTTGTAAATGAT
          TTCAAAGTGAGTGTAAACAGAAACTGTTCAACATTCGCCATGTGCCGGGTTTAAGCGTGAATAAATTACAATTACACGCG
          TCAAACTGCGCAGCAAAATATGCTAGTGAAAAGTGCCACAACAGCAAAGGGAGCCGCACTTGCCAGGTCCTCGGCTGCAG
          CATTAATTTGAGGGGAAAGCAGGAAAAGCGAGGACAACCAGGAAAAACCCATCCAGCGAAAAGGATGCACTAAGCCCGCG
          GCGGAGCCCACCCATCTCCCGTCTCTTTCCGGCACGCTCCCCTGTCGCCGTCCCTTTCTATTGGAGAACCAGCGCGGAAG
          AAGCAGCACAGAGGCAAAATGAATATTGGCATCGCAGCACCGAAATGGGATAAATTGTCGCCACGCGAGTTTTTGCAGCT
          GCAGGAGTTGGCCTCATATTCTACCCGAAAGCTGCAGGATGTGCTGCGGGAGTTCAGCTCGCCGAGTGCCGCCAGCACGC
          CCAAGTGCATTCCGGATGGGGACATTGATTTCGACGGGTTCCGGCGCTTCCTGGACGCCTTCCTCGACTGCGAGGCGCCG
          TTGGACCTGGCCAAACATTTGTTTGTGTCCTTCCTCAAGCCGAATGTCACCCAGGCCCAGCTGCATGGCCGGGCACTTAA
          TCAAATGGCCGCCATCAGCAGCACGGCCGCCTGTGCGCCGGTCACGTCGCACACGAAGGCAGTTTCACGCATTTTGCCAG
          CAATTGGACGGCATTGTCCTGGAAGTTTAGAGAGTGGGAGTGCACAGGCAGAAAAGAGGGCTGACATTAAGCTCCTCGCG
          CGAAAACTCTCCCATTTCGATCCGCTGACACTCAAGGTCCCGCTGAAGGATGTCGTCTGCTATTTATCACTGCTCGAGGC
          AGGACGACCGGAGGACAAGCTGGAGTTCATGTTCCGGCTGTACGACACGGATAGCAACGGAGTCCTGGACACGGCCGAAA
          TGGACGCCATTGTTAACCAGATGATGGCCGTGGCCGAATACCTCGGCTGGGATGTCAGCGAACTGCGTCCGATACTGCAA
          GAGATGATGGTTGAAATCGACTACGATGCCGATGGCACGGTGTCCTTGGACGAGTGGCAGCGAGGCGGGATGACTACGAT
          TCCACTGCTGGTGCTCCTGGGTGTCGACAGCACCACGCTCAAGGAGGATGGCATCCACGTGTGGCGCCTGAAGCACTTCA
          GCAAGCCGGCGTACTGCAATCTCTGCCTCAACATGTTGGTGGGTCTCGGCAAGAAGGGCCTCTGCTGTGTGCTTTGCAAG
          TACACCGTCCATGAGCGATGCGTGCAACATGCTCCCGCGTCCTGCATCACCACCTACGTCAAGTCCAAGAAACCAAAGTG
          CGGCGGAGACCTACTGCATCACTGGGTGGAGGGCAACTGCTATGGACGGTGCTCCAAGTGCCGCAAAAGGATAAAGGCCT
          ACCACGGAATCACAGGACTTACCTGCCGCTGGTGTCACATGATGCTCCACAACCGCTGCGCCTCGTCGGTGAAGAAGGAG
          TGCACCTTGGGCGAATACTCCGAGCTAATTGTCCCGCCCACGGCCATCTGCCCGGCGGTACTCGACCGCCAGCGATCCGT
          GAATCAGGCTCACAAGGCCACGCACTTCCAAATCACGCCGCCGGACGAGCTGAGCTGCCCGCTGCTGGTGTTCGTCAATC
          CGAAGAGCGGCGGTCGCCAGGGGGATCGCATCCTGCGGAAGTTCCAGTACATGCTCAATCCGCGCCAGGTGTACGACCTG
          TCCAAGGGCGGGCCCAAGGAGGGACTCACACTCTTCAAGGACCTGCCTCGCTTCAGGGTCATTTGCTGTGGCGGCGACGG
          CACCGTCGGCTGGGTTTTGGAAGCCATGGACTCCATAGAGTTGGCCAGCCAGCCGGCCATCGGAGTGATTCCCCTGGGAA
          CGGGCAACGACCTGGCTCGCTGTCTCCGCTGGGGCGGTGGATACGAGGGCGAAAACATCCCCAAACTGATGGACAAGTTT
          CGAAGAGCCTCCACCGTCATGCTGGACCGCTGGAGCATCGAGGTGACCAATACTCCGCACAGCGATGACATGCGACCCAA
          GGTGACGCTGCACTCGAACATGCAGAAGGTGATTGAGCTGTCGCAAAGTGTTGTGGTCGACAAATCGCTGATGGAACGCT
          TCGAGGAAATCCAACGGCAGAGCAAGCAGGTGGCCACGTCCATGGGCACGGCGGCCTCAAGCACATCGATTATGATGGCC
          AGCAAGACGGAAACGGAAATGGAAACGATGGCCACGATGGAGTTCGGCAGCAGCACGACCACCACCAACAGAACGACCAC
          GACCAAGAGCATTTCGATGTCCACGTTCGAGACGCAGTGCCTGCAACAGACCCTGCGGACAGCGATGAGCAGCAGCAGCA
          GCAACACGAGCAGCGGCAGTCCGTGCAACGGCAACCAGGATGCGGAAACGGAAGTAGATTCCCATGCCGCTGCCGCTGCC
          GATGTCCGGGAGAAGTCCGTGCCCAGGAGGTCGGGTGAAACGGAAAAGCAATCACTTGAGACGCTGCTGCTGCAGCACAA
          ACAGCAGATGCAACAACAGCAGCAGCAACAGCAGCAAGGAGTCACATCACTAGCTGTCGAGGAAGCTGCAACAGCAACGC
          CAGTCGGGAGTAATCAAAGCGATAATAGTAGCCAGCGCAATAAGCAAAACAACATCCTTAAACAGCAAATTACATTGTCA
          TTGGACTTGTCCGACCATGAGGACGAGCCCAAGGACGATGGCGGTGGCGCTGGCGATGGTACCAAGAGCAACGGCAACAG
          CATTCCGGCAACACCAGCCACACCAATCACACCCACCACTCCGAATGCCGCATCAAGTGTGCTGCAGCAACAACAGCAAC
          AGCATCTCCAGTTCGAGCAGCAACAGAAGCCCATCAAAGTGCAATCCGACAAGGACTGCACGGTGCCCTACAACATAATC
          AACAATTATTTCTCCGTCGGCGTGGACGCCGCCATCTGCGTCAAGTTCCACCTGGAGCGTGAGAAGAACCCGCACAAATT
          CAACAGCCGCATGAAGAACAAGCTGTGGTACTTCGAGTATGCAACATCCGAGACATTTGCGGCATCCTGCAAGAATCTCC
          ACGAGAGCATCGAGATTGTGTGCGATGGCGTGGCCCTGGACTTGGCCAACGGACCCCACTTGCAGGGAGTGGCTCTGCTC
          AACATCCCGTACACACACGGCGGTTCCAACCTGTGGGGCGAGCACCTGTCTCAGAAACGGATCCGCAAGAGTGCCGGCCC
          CTTCGGCAAGAGTAAGAAACTACGCGCCGGCGACAAGGAGTTCTCCGCCACCAGCTTCAATTCCGTGGACCTCTCGGTGG
          CCATTCAGGACTTTGGAGATCGGCTCATCGAGGTAATTGGGCTGGAGAACTGCCTGCACATGGGCCAGGTGAGGACTGGA
          CTTCGCGCGTCGGGACGCCGCCTGGCCCAGTGCAGCGAAGTGATCATCAAGACGAAGAAAACATTTCCCATGCAGATAGA
          TGGCGAGCCCTGGATGCAGATGCCCTGCACGATCAAGGTGACCCACAAGAACCAGGTGCCCATGCTGATGGCACCGCGGT
          CGGAAAAGGGACGCGGATTCTTCAACCTGCTGTGCAGCTGATTCAGGCGCAGCGCATCGAGCGACTTCATGGGCCGGAGT
          GCCCAGGAGTCGGCCGATGAGCTGGATGATGACTTTCGGATCGTCCCTAGAAGCACCACCGTCCACAACATAGCCTAGCG
          TCAATAGCTTTAGCCCAGTCCACCCGCGATCGCATCGAATTGGTTAACCCTAGGTTAAGGCTTCCCTTATGATATGATAT
          GATATGACATGATATGATATGATATGTGTAGATCTGCTATATGTGTATGTATTCTTGTATGCATGTATGTCGAGTGAGTT
          ACAGAGCTTTATATTTAGTGTTAGACTAGCCAAATATACAACCGAGTCAAGTCC
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0112580
          4450
          FBtr0112581
          4238
          FBtr0112579
          3152
          FBtr0308589
          6282
          FBtr0308590
          2923
          FBtr0346954
          4214
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0303271
          1139
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0111492
          1211
          FBpp0111493
          1108
          FBpp0111491
          791
          FBpp0300813
          1230
          FBpp0300814
          747
          FBpp0312418
          1100
          Comments

          Stop-codon suppression (UGA) postulated; reflected in aa sequence of predicted polypeptide.

          Transcript terminates at site supported by polyadenylated cDNA.

          translation_exception: stop_codon_readthrough

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          Dgk-RJ
          Secondary FlyBase IDs
            References (0)