Open Close
General Information
Symbol
Dmel\foxo-RG
Species
D. melanogaster
Annotation Symbol
CG3143-RG
FlyBase ID
FBtr0337094
Feature type
Associated gene
Evidence Rank
Length (nt)
3450
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 36 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        CTACCCATAAAAAAAAAACAAACCCATAAAAAAGTGCAAAGCAACCAGGAAAATAAAGTAAAACAGTGCCAGTTAACAAC
        AGCAAACGGCGATCAACAAATCCCACCGGCAAAATCAACAATTTTTTAAATCGCAATCAACAAGGAGCAACAAATTAGCC
        AGCTATTTCCCATTGCAAACATTTGGCGGATTGATTGCGAAGCTTTCACATTCGCTTCGATATCTTTTGGGCTGGCGAGG
        ATTGCTTGAAGAGCCGCAAAGCTGCAACTGCACAACGAACTTTTCTACCCCATGATGGACGGCTACGCGCAGGAATGGCC
        CAGGCTGACCCACACAGATAACGGCCTGGCCATGGACCAGCTGGGCGGGGATCTGCCCCTGGACGTGGGCTTCGAGCCAC
        AGACCCGGGCCAGATCCAACACATGGCCATGTCCGCGTCCCGAAAACTTTGTGGAGCCCACCGACGAGTTGGACAGTACA
        AAGGCCAGCAATCAGCAGTTGGCCCCAGGAGACTCACAGCAGGCTATACAGAATGCGAATGCAGCCAAGAAGAACTCATC
        GCGTCGCAATGCATGGGGAAATCTATCCTATGCGGATCTCATCACGCATGCCATTGGATCGGCCACCGACAAACGATTGA
        CACTGAGTCAGATTTACGAGTGGATGGTCCAGAATGTGCCATATTTCAAGGACAAGGGCGATTCGAATAGCAGTGCCGGA
        TGGAAGAACTCCATACGTCACAATCTGTCGCTGCACAACCGCTTTATGAGGGTCCAAAACGAGGGCACCGGCAAGTCATC
        CTGGTGGATGCTCAACCCGGAGGCCAAGCCCGGCAAGTCTGTGCGCCGCCGTGCCGCTTCCATGGAGACGTCCCGGTACG
        AGAAGCGGCGCGGCAGGGCCAAGAAGCGGGTGGAGGCACTGCGTCAGGCGGGCGTGGTGGGCCTCAACGATGCCACGCCC
        TCGCCCAGCAGCAGCGTCAGCGAGGGGCTGGATCACTTTCCCGAGAGTCCGCTCCACAGTGGCGGTGGCTTCCAATTATC
        GCCCGATTTCCGGCAACGCGCCTCATCCAATGCCAGTTCCTGCGGACGCCTGAGCCCCATTAGGGCGCAGGATCTTGAGC
        CCGACTGGGGATTCCCCGTTGACTACCAGAACACAACGATGACGCAGGCCCACGCCCAGGCGCTCGAGGAGCTGACGGGC
        ACAATGGCGGATGAGCTGACGCTGTGCAACCAGCAGCAGCAAGGGTTCAGTGCCGCCTCGGGACTTCCCTCTCAGCCCCC
        GCCCCCGCCCTATCAGCCGCCGCAGCATCAACAGGCGCAGCAGCAGCAACAGCAGCAGTCGCCCTACGCCCTCAACGGCC
        CCGCCTCCGGCTACAACACGCTGCAGCCGCAGTCGCAGTGCCTGCTGCACCGGTCCCTCAATTGCAGTTGCATGCACAAT
        GCAAGAGATGGTCTCTCGCCGAACTCAGTAACCACAACAATGTCGCCCGCCTATCCAAACAGCGAGCCCTCATCGGACTC
        CCTGAACACGTACAGCAACGTGGTGCTCGATGGTCCGGCGGACACTGCGGCACTGATGGTGCAGCAGCAGCAGCAGCAGC
        AGCAACAGCAACAGCTGTCCGCCAGCTTGGAAGATAATAACTGCGCCTCTACTTTGATAGGACAATGCCTGGAGGTGCTC
        AATAACGAGGCGCAGCCGATAGACGAATTTAATCTGGAGAACTTTCCCGTGGGCAATCTCGAGTGCAATGTCGAGGAGCT
        GCTGCAGCAGGAGATGAGCTACGGCGGCCTGCTGGACATCAATATACCGCTGGCCACGGTCAACACGAACCTGGTCAACA
        GCAGCAGTGGGCCCCTGAGCATCAGCAACATTAGCAACCTCAGCAACATAAGCAGCAATTCCGGCAGCAGTCTCAGTCTG
        AATCAGTTGCAGGCTCAGCTGCAACAGCAGCAGCAGCAGCAGCAGGCGCAGCAACAGCAGCAGGCGCAGCAGCAACAACA
        GCAGCATCAGCAGCACCAGCAACAGTTGCTGCTAAATAATAACAACAACAGCAGCAGCAGCCTGGAATTGGCAACACAAA
        CGGCTACCACAAATCTGAATGCTCGGGTTCAGTACTCACAGCCCAGCGTGGTGACCTCGCCACCATCCTGGGTGCACTAG
        ATCCACTGTGGGTCGATCGTAATCCAAATCGCAAGGATGATCGTTATAGCCGGTAGTCGTCGTTGTTGTGTGTGTGCGTG
        TGTGTTGTTTGTGTCGCCATTGGAATGCTTTAAACGCTAATTCTAAGAACCGTAGTGTAAAGAATTGTAAGCAGCCGCAG
        CTGGTTGGGAAACTGGAAACGAGGATTCGGATGCGGAGTCGATGTCTTTATCGGGTATGCAGCAGCTGCAGGATCAGTGA
        GCCGAAAGCGGGAGCCGCAGCTGGACCGTCACTAAAAAGTTTACAAAGATAAATCTGGTCGCTTCTAATCTAACATACAT
        ACATACAATACATATACATAGATATATAACTACAATTATATAGTTATGCATTACACATAGAAACGAAGCATACAAATAAT
        ACCAATTAATCACCAATAATTAGATGCTACAATTTGTGAAATTCTCTGAGTGGCAGAGAGCTGAGAAAACATCTTTGGCC
        ACCAATGAAGGGAAATTTGAATTGAATTGAAAACACGGTTTAGTTATTAGGTTCAACTTTGTACATATTAATTTTAATAA
        CCTTGACGTAATGAAACCCACAAATAATAATAATACTTCTAATGATAATAAACAACAAGAAACAGCGTAAAACGTAAACT
        AAATGTTCGACAACTAAATGGAAAAATATTTGCTAGCCAGCAGTCATCGAGGAAAATAGAAACAAGAAAATGGCAACAGA
        AAATATAAATGAAAAACATAAGAAATTAGCACAATTATGTAATAATTAATGCTTAATTAATGTATTTAATTGAAGGTCTA
        ATTGTAATTGTATATTTTTTTCTATAAAGAGCAAAGAAAACCCTTAAAGAAGAATACAACTTGTGTAAAAATTATGCTTA
        AGATTCGCAATGATATACGTAATAAATTCTCCGATTAGTTAGCACACATCAAATCAGCTCGGCTTTAAAAATAAAACCCT
        TTGTTACATAATTATGCCAACATCCATATGTAGATCGTAGACCTATAACAAAGATTTGAGTGTAATACAATTAATTTCAT
        ATATTATTAGTAAATGTAAATGTTGATAGGCAAAAGAAAAAAACAAAATTATAACAGAATAGCCACAAAACTCAAAAACC
        CAGCAGAACTAAAAGCATAAAGTAATAAGCAAATAAATGCGCATCATTGTGTACTATTATGGGCTAAATGTTAATTATTA
        ACTAGATTGTACAATTCAAATGTAGTTCATACTATTTAAAATGCAAAAACGGAGTGAAGATGAATAAACTGATGATTCAA
        TATAAGAATT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0082886
        3939
        FBtr0082887
        3548
        FBtr0305052
        3708
        FBtr0346723
        3566
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0308010
        622
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0089343
        613
        FBpp0089344
        613
        FBpp0293589
        622
        FBpp0312334
        619
        Comments

        5' UTR based on RNA-Seq and/or EST data.

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (1)
        Reported As
        Symbol Synonym
        foxo-RG
        Secondary FlyBase IDs
          References (0)