Open Close
General Information
Symbol
Dmel\foxo-RH
Species
D. melanogaster
Annotation Symbol
CG3143-RH
FlyBase ID
FBtr0346723
Feature type
Associated gene
Evidence Rank
Length (nt)
3566
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 25 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          TTCAGTTGTCAGTTCGCATCCAACTAGAAAGCAGTTAACGAGTAGTCTGTGTTTTTTCGCTTGCGGTTAAAAGCCACGAG
          AAATCCGCACAAGTTTCGCTCAAAACAACAACACAATCATATATACTACCCATAAAAAAAAAACAAACCCATAAAAAAGT
          GCAAAGCAACCAGGAAAATAAAGTAAAACAGTGCCAGTTAACAACAGCAAACGGCGATCAACAAATCCCACCGGCAAAAT
          CAACAATTTTTTAAATCGCAATCAACAAGGAGCAACAAATTAGCCAGCTATTTCCCATTGCAAACATTTGGCGGATTGAT
          TGCGAAGCTTTCACATTCGCTTCGATATCTTTTGGGCTGGCGAGGATTGCTTGAAGAGCCGCAAAGCTGCAACTGCACAA
          CGAACTTTTCTACCCCATGATGGACGGCTACGCGCAGGAATGGCCCAGGCTGACCCACACAGATAACGGCCTGGCCATGG
          ACCAGCTGGGCGGGGATCTGCCCCTGGACGTGGGCTTCGAGCCACAGACCCGGGCCAGATCCAACACATGGCCATGTCCG
          CGTCCCGAAAACTTTGTGGAGCCCACCGACGAGTTGGACAGTACAAAGGCCAGCAATCAGCAGTTGGCCCCAGGAGACTC
          ACAGCAGGCTATACAGAATGCGAATGCAGCCAAGAAGAACTCATCGCGTCGCAATGCATGGGGAAATCTATCCTATGCGG
          ATCTCATCACGCATGCCATTGGATCGGCCACCGACAAACGATTGACACTGAGTCAGATTTACGAGTGGATGGTCCAGAAT
          GTGCCATATTTCAAGGACAAGGGCGATTCGAATAGCAGTGCCGGATGGAAGAACTCCATACGTCACAATCTGTCGCTGCA
          CAACCGCTTTATGAGGGTCCAAAACGAGGGCACCGGCAAGTCATCCTGGTGGATGCTCAACCCGGAGGCCAAGCCCGGCA
          AGTCTGTGCGCCGCCGTGCCGCTTCCATGGAGACGTCCCGGTACGAGAAGCGGCGCGGCAGGGCCAAGAAGCGGGTGGAG
          GCACTGCGTCAGGCGGGCGTGGTGGGCCTCAACGATGCCACGCCCTCGCCCAGCAGCAGCGTCAGCGAGGGGCTGGATCA
          CTTTCCCGAGAGTCCGCTCCACAGTGGCGGTGGCTTCCAATTATCGCCCGATTTCCGGCAACGCGCCTCATCCAATGCCA
          GTTCCTGCGGACGCCTGAGCCCCATTAGGGCGCAGGATCTTGAGCCCGACTGGGGATTCCCCGTTGACTACCAGAACACA
          ACGATGACGCAGGCCCACGCCCAGGCGCTCGAGGAGCTGACGGGCACAATGGCGGATGAGCTGACGCTGTGCAACCAGCA
          GCAGCAAGGATCGTACGGTTGGAGCAGGTTCAGTGCCGCCTCGGGACTTCCCTCTCAGCCCCCGCCCCCGCCCTATCAGC
          CGCCGCAGCATCAACAGGCGCAGCAGCAGCAACAGCAGCAGTCGCCCTACGCCCTCAACGGCCCCGCCTCCGGCTACAAC
          ACGCTGCAGCCGCAGTCGCAGTGCCTGCTGCACCGGTCCCTCAATTGCAGTTGCATGCACAATGCAAGAGATGGTCTCTC
          GCCGAACTCAGTAACCACAACAATGTCGCCCGCCTATCCAAACAGCGAGCCCTCATCGGACTCCCTGAACACGTACAGCA
          ACGTGGTGCTCGATGGTCCGGCGGACACTGCGGCACTGATGGTGCAGCAGCAGCAGCAGCAGCAGCAACAGCAACAGCTG
          TCCGCCAGCTTGGAAGGACAATGCCTGGAGGTGCTCAATAACGAGGCGCAGCCGATAGACGAATTTAATCTGGAGAACTT
          TCCCGTGGGCAATCTCGAGTGCAATGTCGAGGAGCTGCTGCAGCAGGAGATGAGCTACGGCGGCCTGCTGGACATCAATA
          TACCGCTGGCCACGGTCAACACGAACCTGGTCAACAGCAGCAGTGGGCCCCTGAGCATCAGCAACATTAGCAACCTCAGC
          AACATAAGCAGCAATTCCGGCAGCAGTCTCAGTCTGAATCAGTTGCAGGCTCAGCTGCAACAGCAGCAGCAGCAGCAGCA
          GGCGCAGCAACAGCAGCAGGCGCAGCAGCAACAACAGCAGCATCAGCAGCACCAGCAACAGTTGCTGCTAAATAATAACA
          ACAACAGCAGCAGCAGCCTGGAATTGGCAACACAAACGGCTACCACAAATCTGAATGCTCGGGTTCAGTACTCACAGCCC
          AGCGTGGTGACCTCGCCACCATCCTGGGTGCACTAGATCCACTGTGGGTCGATCGTAATCCAAATCGCAAGGATGATCGT
          TATAGCCGGTAGTCGTCGTTGTTGTGTGTGTGCGTGTGTGTTGTTTGTGTCGCCATTGGAATGCTTTAAACGCTAATTCT
          AAGAACCGTAGTGTAAAGAATTGTAAGCAGCCGCAGCTGGTTGGGAAACTGGAAACGAGGATTCGGATGCGGAGTCGATG
          TCTTTATCGGGTATGCAGCAGCTGCAGGATCAGTGAGCCGAAAGCGGGAGCCGCAGCTGGACCGTCACTAAAAAGTTTAC
          AAAGATAAATCTGGTCGCTTCTAATCTAACATACATACATACAATACATATACATAGATATATAACTACAATTATATAGT
          TATGCATTACACATAGAAACGAAGCATACAAATAATACCAATTAATCACCAATAATTAGATGCTACAATTTGTGAAATTC
          TCTGAGTGGCAGAGAGCTGAGAAAACATCTTTGGCCACCAATGAAGGGAAATTTGAATTGAATTGAAAACACGGTTTAGT
          TATTAGGTTCAACTTTGTACATATTAATTTTAATAACCTTGACGTAATGAAACCCACAAATAATAATAATACTTCTAATG
          ATAATAAACAACAAGAAACAGCGTAAAACGTAAACTAAATGTTCGACAACTAAATGGAAAAATATTTGCTAGCCAGCAGT
          CATCGAGGAAAATAGAAACAAGAAAATGGCAACAGAAAATATAAATGAAAAACATAAGAAATTAGCACAATTATGTAATA
          ATTAATGCTTAATTAATGTATTTAATTGAAGGTCTAATTGTAATTGTATATTTTTTTCTATAAAGAGCAAAGAAAACCCT
          TAAAGAAGAATACAACTTGTGTAAAAATTATGCTTAAGATTCGCAATGATATACGTAATAAATTCTCCGATTAGTTAGCA
          CACATCAAATCAGCTCGGCTTTAAAAATAAAACCCTTTGTTACATAATTATGCCAACATCCATATGTAGATCGTAGACCT
          ATAACAAAGATTTGAGTGTAATACAATTAATTTCATATATTATTAGTAAATGTAAATGTTGATAGGCAAAAGAAAAAAAC
          AAAATTATAACAGAATAGCCACAAAACTCAAAAACCCAGCAGAACTAAAAGCATAAAGTAATAAGCAAATAAATGCGCAT
          CATTGTGTACTATTATGGGCTAAATGTTAATTATTAACTAGATTGTACAATTCAAATGTAGTTCATACTATTTAAAATGC
          AAAAACGGAGTGAAGATGAATAAACTGATGATTCAATATAAGAATT
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0082886
          3939
          FBtr0082887
          3548
          FBtr0305052
          3708
          FBtr0337094
          3450
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0312334
          619
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0089343
          613
          FBpp0089344
          613
          FBpp0293589
          622
          FBpp0308010
          622
          Comments

          Transcript terminates at site supported by polyadenylated cDNA.

          Unconventional splice site postulated (GT-CG).

          transcript_exception: non_canonical_splice_site

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          foxo-RH
          Secondary FlyBase IDs
            References (0)