Df(2L)Top2^Df35 has a deletion of sequences from 2L:19453177 through 2L:19458475 . Sequencing indicates that sequences lie between these breakpoints. At the left breakpoint, 2L:19453176 is joined to sequences beginning at 3R:16529574 and extending distally on 3R. The junction sequence is CTATATCCATCATATTAAAG|AAATTAAGTTAATAACTATA. At the right breakpoint sequences from the middle of P{EP} (the deletion was generated by imprecise excision of a P{EP} insertion) are juxtaposed to 2L:19458476 . The longest sequence read (TACGCAAAGCTTGGCGCAGAGATCTCGACGTGTTCACTTTGCTTGTTTGAATTGAATTGTCGCTCCGTAGACGAAGCGCCTCTATTTATACTCCGGCGCTCTCTCGGTACCCTCGACCCTTGCCGGAGGACAGTACTCCGCCAGCCCGGAGGACAGTACTCCCGCCTTGCGTCGGAGGACAGTACTCCGACCTCTAGTGTCGGA|GTCCAAGTGCAGGGTGTCCAAAGTCAGAATCCT) suggests that the 3' P{EP} end lies between the deletion breakpoints. In addition, sequencing suggests that there is a nearby inversion or translocation breakpoint on the Df(2L)Top2^Df35 chromosome - though it may reflect the presence of a novel breakpoint involving the balancer in the stock. The breakpoint lies at 2L:19459132..19459133 and juxtaposes 2L:19459132 to repetitive sequences (ATTCCGAGGACGACAGAAATCTTTTTGACCAGTAACTAAAGAAAGTCATTAC|CTCCAGCACCCCCAAATATTTAGGGCTGACCCTAGACAGAAGGCTGACTTGGGGCCCCCACATCAACAGTAAGCGTATCCAGGCCAACATACGCCTAAAGCAACTCCACTGGCTCATCGGTAAAAAGTCCAAGCTGCGAGAGAAACTAAAGATTCTCGTCTACAAGACTATTCTCAAGCCAATCTGGACGTACG).

Imprecise excision of an insertion, resulting in a deletion that removes Top2.