Whole-genome sequence of a Df(2L)Top2Df35 stock showed a deletion of sequences from  2L:19453177  through  2L:19458475  (i.e.  2L:19453176--19453177 ; 2L:19458475--19458476 ). This region extends from the first intron of Top2 to the region between CG12006 and tj.
The sequencing indicated that sequences lie between these breakpoints.
At the left breakpoint,  2L:19453176  is joined to sequences beginning at  3R:16529574  and extending distally on 3R. The junction sequence is  
CTATATCCATCATATTAAAG|AAATTAAGTTAATAACTATA
Df(2L)Top2Df35 was generated by imprecise excision of a P{EP} insertion (Hohl et al., 2012; FBrf0220101). At the right deletion breakpoint, sequences from the middle of P{EP} are juxtaposed to  2L:19458476 . The longest sequence read was
TACGCAAAGCTTGGCGCAGAGATCTCGACGTGTTCACTTTGCTTGTTTGAATTGAATTGTCGCTCCGTAGACGAAGCGCCTCTATTTATACTCCGGCGCTCTCTCGGTACCCTCGACCCTTGCCGGAGGACAGTACTCCGCCAGCCCGGAGGACAGTACTCCCGCCTTGCGTCGGAGGACAGTACTCCGACCTCTAGTGTCGGA|GTCCAAGTGCAGGGTGTCCAAAGTCAGAATCCT
which suggests the 3' P{EP} end lies between the deletion breakpoints.
In addition, the sequencing suggested that there is a nearby inversion or translocation breakpoint on the Df(2L)Top2Df35 chromosome--though it may reflect the presence of a novel breakpoint involving the balancer in the stock. The breakpoint lies at  2L:19459132..19459133  and juxtaposes  2L:19459132  to repetitive sequences:
ATTCCGAGGACGACAGAAATCTTTTTGACCAGTAACTAAAGAAAGTCATTAC|CTCCAGCACCCCCAAATATTTAGGGCTGACCCTAGACAGAAGGCTGACTTGGGGCCCCCACATCAACAGTAAGCGTATCCAGGCCAACATACGCCTAAAGCAACTCCACTGGCTCATCGGTAAAAAGTCCAAGCTGCGAGAGAAACTAAAGATTCTCGTCTACAAGACTATTCTCAAGCCAATCTGGACGTACG