A TI{KozakGAL4} DNA cassette has been inserted into CG16998, replacing the coding sequence (coordinates of deleted sequence are 3L:7538903..7539837 , release 6 genome). The 3' end of the deletion extends 156 bp downstream of the annotated 3' end of the CG16998 gene. This results in a simultaneous knock-out of CG16998 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of CG16998 (predicted to gene trap all annotated transcripts of the gene). The deletion also removes part of the 3' UTR of the lqf-RH isoform (none of the transcribed regions of the other annotated lqf isoforms are deleted). The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with a 3' homology arm of length 200bp and the 5' homology arm extended to restore the promoter. The sgRNA sequences used to target the gene were: AGTAGGTCGCATGCCAAACCCGG and AGAGCGGCTCCTCAGATGGCTGG.