A TI{KozakGAL4} DNA cassette has been inserted into CG32568, replacing the coding sequence (coordinates of deleted sequence are X:16740917..16742174 , release 6 genome). This results in a simultaneous knock-out of CG32568 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of CG32568 (predicted to gene trap all annotated transcripts of the gene). The deletion is also within a coding intron of the goe gene. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: TAAACCTCACTTCTCATTGAAGG and AGTTCTTATATAATCTACTTAGG.