A TI{KozakGAL4} DNA cassette has been inserted into CG31759, replacing the coding sequence (coordinates of deleted sequence are 2L:12208167..12209846 , release 6 genome). This results in a simultaneous knock-out of CG31759 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of CG31759 (predicted to gene trap all annotated transcripts of the gene). The deletion also removes part of bru1 (CG31759 is nested within an intron of bru1). The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: GACAATAGCGAAACTCTAGTTGG and AGCCAATACTGCGATACCATCGG.