A TI{KozakGAL4} DNA cassette has been inserted into Corp, replacing most of the coding sequence (coordinates of deleted sequence are X:8270345..8271312 , release 6 genome). This results in a simultaneous knock-out of Corp plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Corp (predicted to gene trap all annotated transcripts of the gene). The insertion is also within a coding intron of CG1632 (gene on the opposite strand) and is not predicted to gene trap this gene. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: ATTGATAACGATCTTCACACTGG and ATGCGAATCGAGCGCATGACAGG.