A TI{KozakGAL4} DNA cassette has been inserted into eIF3g2, replacing the coding sequence (coordinates of deleted sequence are 3R:20408326..20409164 , release 6 genome). This results in a simultaneous knock-out of eIF3g2 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of eIF3g2 (predicted to gene trap all annotated transcripts of the gene). The insertion and associated deletion is also within an intron of Gfrl. The 5' end of the deletion associated with the insertion is 455 bp upstream of the 5' end of the Tmlh gene and may affect its transcription. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique. The sgRNA sequences used to target the gene were: TTTACTTGGCCTGTTGAGATGGG and AGCAGAGAAGCGAATACACAAGG.