A TI{KozakGAL4} DNA cassette has been inserted into Mtk, replacing the coding sequence (coordinates of deleted sequence are 2R:15408864..15409124 , release 6 genome). This results in a simultaneous knock-out of Mtk plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Mtk (predicted to gene trap all annotated transcripts of the gene). The deletion also removes part of Stacl (Mtk is nested within an intron of Stacl). The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: TTGCATCTTAGCTCGGTGGCGGG and GAACATCAAAGCTTGTCATTGGG.