A TI{KozakGAL4} DNA cassette has been inserted into Argk3, replacing most of the coding sequence (coordinates of deleted sequence are 3R:15846757..15848265 , release 6 genome, and the 3' end of the deletion is 18bp upstream of the stop codon). This results in a simultaneous knock-out of Argk3 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Argk3 (predicted to gene trap all annotated transcripts of the gene). The deletion also removes part of cv-d (Argk3 is nested within cv-d). The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: ATTTATGTTTACTTGATTCTCGG and GAGGAAGAGCTCGAAATATCCGG.