A TI{KozakGAL4} DNA cassette has been inserted into CG1827, replacing the coding sequence (coordinates of deleted sequence are 2R:9589085..9590381 , release 6 genome). This results in a simultaneous knock-out of CG1827 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of CG1827 (predicted to gene trap all annotated transcripts of the gene). The deletion also removes part of clos (CG1827 is nested within an intron of clos). The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: GTCCCTGTTCTGCCGGAAAATGG and GTAAATATCGTGGCGTTGTGAGG.