Imprecise excision of the P{EP}Apc2G5028 insertion such that only 45 nucleotides of the original insertion remain.
45 nucleotides (ATGATGAAATAACATATGTTATTTATTAAATATGTtATTTCATCATGG) remain at the site of the imprecise excision of P{EP}Apc2G5028. There are 5 ATGs in this sequence but none are in frame with the Apc2 start.
ATGATGAAATAACATATGTTATTTATTAAATATGTTATTTCATCATGG
Apc2123/Apc2[+] is a suppressor of eye photoreceptor cell phenotype of ApcQ8