Genomic fragment containing CG3226.
CG3226 rescue fragment created with primers tctaagcgacgagcagcata and tggtgcttgtggt ggtttta.
CG3226+tCa rescues Df(1)f08054-d09974/+
CG3226+tCa rescues Df(1)Exel6240/+
Expression of CG3226+tCa rescues the cardiomyopathy phenotype seen in Df(1)Exel6240/+ females. End systolic dimension (ESD) and fractional shortening (FS) are both comparable to wild type in the rescue flies.
Expression of CG3226+tCa rescues the cardiomyopathy phenotype seen in Df(1)f08054-d09974/+ females. End systolic dimension (ESD) and fractional shortening (FS) are both comparable to wild type in the rescue flies.