Imprecise excision of P{GSV6}UtxGS10564, resulting in a 1,691 bp deletion of 5 exons of Utx, from ggttatttgtatgtatgtat to taaaccaatcagtgggcaat.
1,691 bp deletion resulting from the imprecise excision of P{GSV6}UtxGS10564, extends from ggttatttgtatgtatgtat to taaaccaatcagtgggcaat.
UtxΔ95 homozygotes only rarely survive to adults.
UtxΔ95/Utx1 animals can develop into adults, which show no detectable morphological defects.
UtxΔ95/Utx1 embryos show a markedly lower hatching rate compared to wild type. Treatment with 10 Gy of ionizing radiation reduces the hatching rate of UtxΔ95/Utx1 embryos to a greater extent than that of wild type. In contrast, the hatching rate of mutant embryos is not significantly different to wild type after UV radiation exposure.