A complex substitution consisting of a 1bp insertion, an 8bp deletion and 14 base substitutions. This results in a truncated protein of only 32 residues.
Frameshift mutation that is predicted to generate a stop codon at position 32.
ATCTGTCACCCGTAAGCGTCCC
Comment - A complex substitution consisting of a 1 base insertion, an 8 base deletion, and 14 base substitutions causing a frameshift starting at amino acid 21 of Esyt2-PA and early translation termination after the addition of 11 novel amino acids.
Esyt21/Esyt2MB02922 third instar larvae do not display any significant differences in the number of synaptic boutons, nor the number or density of active zones at neuromuscular junction relative to controls. No differences in the frequency or amplitude of miniature excitatory postsynaptic currents (mEPSCs) in abdominal muscles of the mutant larvae are observed in either low (0.4 mM) or high (3 mM) extracellular Ca[2+] concentrations, but the amplitude of the excitatory postsynaptic currents is about halved (with a concomitant decrease in quantal content) compared to wild-type at both low and high Ca[2+]. The mutants also exhibit defects in short-term synaptic plasticity: at 0.4 mM Ca[2+] they show enhanced facilitation and at 3 mM Ca[2+] reduced depression relative to controls. However, Esyt21/Esyt2MB02922 larvae show similar rate of vesicle pool depletion during high frequency (10Hz) stimulation as controls as well as comparable pool recovery rate. No significant change in the density or distribution of synaptic vesicles within NMJ boutons is observed in these larvae and active zone length as well as T-bar morphology is also normal.
The reduced amplitude of excitatory postsynaptic currents (EPSC) in abdominal muscles as well as the defects in short-term synaptic plasticity observed in Esyt21/Esyt2MB02922 mutant third instar larvae at either low or high extracellular Ca[2+] are rescued by expression of Esyt2Scer\UAS.RB.T:Zzzz\FLAG driven by Scer\GAL4RapGAP1-OK6. The rescue larvae however show a slight but significant decrease in the amplitude of miniature EPSCs.