Deletion removing part of the iPLA2-VIA transcription unit. Generated by imprecise excision of P{EPgy2}iPLA2-VIAEY05103.
A 1335bp deletion ( 3L:9862707..9864041 ) resulting from the imprecise excision of P{EPgy2}iPLA2-VIAEY05103 removes the 5' end of iPLA2-VIA. The sequence "CATGATGAAATAACACGTACACGTATACACGTATAACA" is inserted at the site of the deletion.
CATGATGAAATAACACGTACACGTATACACGTATAACA
iPLA2-VIAΔ174 mutants show lower performance in odor avoidance behavior (to 3-octanol or 4-methylcyclohexanol).
These mutants show progressive functional and ultrastructure eye defects. There are decreases in electroretinogram amplitudes and in on-transients electroretinogram amplitude; the decreased on-transients electroretinogram amplitude, but not the electroretinogram amplitude is more severe under 12h:12h light;dark cycles than under constant darkness. There is a progressive loss and degeneration of photoreceptors: aberrant photoreceptor cell morphology, swollen postsynaptic dendrites, expanded presynaptic terminals, a decrease in the density of synaptic vesicles, the accumulation of TSV-like structures and omega-like structures, a decrease in capitate projections and an accumulation of lysosomes; there is also an accumulation of aberrant mitochondria by day 30.
The third instar larval fat body in iPLA2-VIAΔ174 mutants show larger and more numerous lysosomes (identified as Lysotracker-positive puncta), as compared to controls.
iPLA2-VIAΔ174 has bang sensitive phenotype, suppressible by Scer\GAL4Act5C.PI/Vps26UAS.Tag:HA
iPLA2-VIAΔ174 has bang sensitive phenotype, suppressible | partially by Vps35UAS.Tag:HA/Scer\GAL4Act5C.PI
iPLA2-VIAΔ174 has bang sensitive phenotype, suppressible | partially by Scer\GAL4Act5C.PI/laceKK102282
iPLA2-VIAΔ174 has abnormal neurophysiology | progressive phenotype, suppressible by Scer\GAL4Act5C.PI/laceKK102282
iPLA2-VIAΔ174 has decreased cell number | progressive phenotype, suppressible by Scer\GAL4Act5C.PI/laceKK102282
iPLA2-VIAΔ174 has abnormal neurophysiology | progressive phenotype, suppressible by Scer\GAL4Act5C.PI/Vps26UAS.Tag:HA
iPLA2-VIAΔ174 has abnormal neurophysiology | progressive phenotype, suppressible | partially by Vps35UAS.Tag:HA/Scer\GAL4Act5C.PI
iPLA2-VIAΔ174 has decreased cell number | progressive phenotype, suppressible | partially by Scer\GAL4Act5C.PI/Vps26UAS.Tag:HA
iPLA2-VIAΔ174 has bang sensitive phenotype, suppressible | partially by Scer\GAL4Act5C.PI/Hsap\PLA2G6UAS.cLa
iPLA2-VIAΔ174 has bang sensitive phenotype, suppressible | partially by Scer\GAL4elav-C155/Hsap\PLA2G6UAS.cLa
iPLA2-VIAΔ174 has short lived phenotype, suppressible | partially by Scer\GAL4Act5C.PI/Hsap\PLA2G6UAS.cLa
iPLA2-VIAΔ174 has short lived phenotype, suppressible by Hsap\PLA2G6S519A.UAS/Scer\GAL4Act5C.PI
iPLA2-VIAΔ174 has abnormal neurophysiology | adult stage | progressive phenotype, suppressible by Scer\GAL4elav-C155/Hsap\PLA2G6UAS.cLa
iPLA2-VIAΔ174 has abnormal neurophysiology | adult stage | progressive phenotype, suppressible by Scer\GAL4Act5C.PI/Hsap\PLA2G6UAS.cLa
iPLA2-VIAΔ174 has bang sensitive phenotype, suppressible | partially by Hsap\PLA2G6S519A.UAS/Scer\GAL4Act5C.PI
iPLA2-VIAΔ174 has abnormal neurophysiology | adult stage | progressive phenotype, suppressible by Hsap\PLA2G6S519A.UAS/Scer\GAL4Act5C.PI
iPLA2-VIAΔ174 has decreased cell number | adult stage | progressive phenotype, suppressible by Hsap\PLA2G6S519A.UAS/Scer\GAL4Act5C.PI
iPLA2-VIAΔ174 has abnormal neurophysiology | progressive phenotype, suppressible | partially by Scer\NDI1UAS.cVa/Scer\GAL4Act5C.PI
iPLA2-VIAΔ174 has short lived phenotype, non-suppressible by Scer\GAL4elav-C155/Hsap\PLA2G6UAS.cLa
iPLA2-VIAΔ174 has retina | progressive phenotype, suppressible by Scer\GAL4Act5C.PI/laceKK102282
iPLA2-VIAΔ174 has retina | progressive phenotype, suppressible by Scer\GAL4Act5C.PI/Hsap\PLA2G6UAS.cLa
iPLA2-VIAΔ174 has retina | progressive phenotype, suppressible by Hsap\PLA2G6S519A.UAS/Scer\GAL4Act5C.PI
iPLA2-VIAΔ174 has eye photoreceptor cell | progressive phenotype, suppressible by Hsap\PLA2G6S519A.UAS/Scer\GAL4Act5C.PI
iPLA2-VIAΔ174 has retina | progressive phenotype, suppressible | partially by Scer\NDI1UAS.cVa/Scer\GAL4Act5C.PI
iPLA2-VIAΔ174 has eye photoreceptor cell | progressive phenotype, suppressible by Scer\GAL4Act5C.PI/laceKK102282
iPLA2-VIAΔ174 has retina | progressive phenotype, suppressible by Scer\GAL4Act5C.PI/Vps26UAS.Tag:HA
iPLA2-VIAΔ174 has retina | progressive phenotype, suppressible | partially by Vps35UAS.Tag:HA/Scer\GAL4Act5C.PI
iPLA2-VIAΔ174 has eye photoreceptor cell | progressive phenotype, suppressible | partially by Scer\GAL4Act5C.PI/Vps26UAS.Tag:HA
iPLA2-VIAΔ174 has lysosome | adult stage | progressive phenotype, suppressible by Scer\GAL4Act5C.PI/Vps26UAS.Tag:HA
iPLA2-VIAΔ174 has synaptic vesicle | adult stage | progressive phenotype, suppressible | partially by Scer\GAL4Act5C.PI/Vps26UAS.Tag:HA
iPLA2-VIAΔ174 has capitate projection | adult stage | progressive phenotype, suppressible by Scer\GAL4Act5C.PI/Vps26UAS.Tag:HA
iPLA2-VIAΔ174 has retina | progressive phenotype, suppressible by Scer\GAL4elav-C155/Hsap\PLA2G6UAS.cLa
iPLA2-VIAΔ174 is rescued by iPLA2-VIA+CH322-150H21
iPLA2-VIAΔ174 is partially rescued by iPLA2-VIAUAS.PA.Tag:HA/Scer\GAL4Act5C.PI
iPLA2-VIAΔ174 is partially rescued by iPLA2-VIAUAS.PA.Tag:HA/Scer\GAL4elav-C155
iPLA2-VIAΔ174 is partially rescued by iPLA2-VIAUAS.PB.Tag:HA/Scer\GAL4Act5C.PI
iPLA2-VIAΔ174 is partially rescued by Scer\GAL4elav-C155/iPLA2-VIAUAS.PB.Tag:HA