Below are the coordinates of the deletions and the sequences surrounding the junctions of the two iPLA2-VIA alleles. iPLA2-VIAΔ192 : The deleted region is 3L:9863722..9864639 . 5’ deletion end seq: 9863722-GTCGTGTCACCGTTTAGTAGACTAGTTGAGAATGTATTAATGT-9863680 Insertion: This sequence (GACCGTGCTCTGTGGAATCAGTGCTTAAAATCGAA) is inserted in the deleted region. 3’ deletion end seq: 9864661-CAATGGCGAACAAAGTGAAGTGT-9864639 iPLA2-VIAΔ174 : The deleted region is 3L:9862707..9864041 . 5’ deletion end seq: 9862707-ACCAATGTTAGCAAGCTGTACACACAGGACATGAAATATGGCGGCACTCCTCTGCA-9862652 Insertion: This sequence (CATGATGAAATAACACGTACACGTATACACGTATAACA) is inserted in the deleted region. 3’ deletion end seq: 9864115-TGATTACGTCGGGCAGCAACGGATAGCGGGAAGGCACGAAAAAACGGGCAGCATTACTGCAATGTAGAGCCATCG-9864041