Deletion removing part of the iPLA2-VIA transcription unit. Generated by imprecise excision of P{EPgy2}iPLA2-VIAEY05103.
A 918bp deletion ( 3L:9863722..9864639 ) resulting from the imprecise excision of P{EPgy2}iPLA2-VIAEY05103 removes the 5' end of iPLA2-VIA. The sequence "GACCGTGCTCTGTGGAATCAGTGCTTAAAATCGAA" is inserted at the site of the deletion.
GACCGTGCTCTGTGGAATCAGTGCTTAAAATCGAA
iPLA2-VIAΔ174 mutants show lower performance in odor avoidance behavior (to 3-octanol or 4-methylcyclohexanol). These mutants also show progressive decreases in electroretinogram amplitudes and in on-transients electroretinogram amplitude.
iPLA2-VIAΔ192 is rescued by iPLA2-VIA+CH322-150H21