Insertion of TI{CRISPaint.T2A-GAL4} sequence into the 5' part of the e coding sequence. The insertion is in antisense orientation (T2A-GAL4 sequence within the inserted sequence cassette is in the opposite orientation to transcription of e); as expected, no GAL4 expression is seen. An indel (5bp deletion, 25bp insertion) is associated with the site of the TI{CRISPaint.T2A-GAL4} insertion.
GTGTACATTTGGGTATCCGTCCACA
Insertion of TI{CRISPaint.T2A-GAL4} sequence into the 5' part of the e coding sequence. The insertion is in antisense orientation (T2A-Scer\GAL4 sequence within the inserted sequence cassette is in the opposite orientation to transcription of e). An indel (5bp deletion, 25bp insertion) is associated with the site of the TI{CRISPaint.T2A-GAL4} insertion.