A T to A point mutation in the intron of the fifth stau exon.
T18120022A
T to A mutations in the splice donor site in the last intron of stau. It is predicted to lead to early translation termination in the intron resulting from the disruption of splicing. There are also several nearby synonym mutations. The sequence GGACTTTGAGGTAAGCTCACCA in wild type is cGAtTTcGAaGaCtcaagcCCt in the mutant where the lower case nucleotides represent the substitutions.