A 560 bp deletion surrounding the TSS of aslncRNA:bsAS, effectively abolishing expression of this gene in L3 and LP in wing imaginal discs. This has little effect on the expression of the short isoform B of bs, but induces overexpression of the long isoforms of bs. As a result, there is an overall increase in the expression of bs.
A 560bp deletion surrounding the TSS of asRNA:bsAS. Some sequence remians at the site of the deletion.
CGGGCATTTTGGGCCATTTTGGGCCGGGC
asRNA:bsASKO has wing vein | ectopic phenotype, suppressible by bsJF02319/Scer\GAL4rn-GAL4-5
asRNA:bsASKO has wing phenotype, suppressible | partially by bsJF02319/Scer\GAL4rn-GAL4-5
asRNA:bsASKO is not rescued by asRNA:bsASUAS.cPa/Scer\GAL4rn-GAL4-5