A TI{CRIMIC.TG4.1} DNA cassette has been inserted into cnn, in a coding intron, and is predicted to gene trap all annotated transcripts of the gene. In addition, the coding exons of cnn downstream of the inserted gene trap cassette have been deleted. The TI{CRIMIC.TG4.1} cassette was inserted via the CRISPR/Cas-9 hybrid technique, using two gRNAs that target cnn : one targeted to a coding intron (GCATCTGCAAAGGAAACAAAGGG) and the other to a non-coding exon in the 3' UTR (CATTGGGTGAATGGCCTCTCGGG). The PCR check gave the expected-sized band for the left flank and no band for the right flank.