A TI{CRIMIC.TG4.1} DNA cassette has been inserted into a coding region of exon 3 of IntS11, but the upstream splice acceptor for exon 3 has been mutated such that the transcript is predicted to splice from exon 2 to the splice acceptor of the CRIMIC Trojan exon and lead to the expression of GAL4. The TI{CRIMIC.TG4.1} cassette was inserted via the CRISPR/Cas-9 hybrid technique, using two gRNAs that target IntS11 : one targeted to a coding intron (AAGAACGTCATGCTCGTCCATGG) and the other to a non-coding exon in the 3' UTR (TTATCTATGGAATTAAGGCGTGG). The PCR check gave the expected-sized band for the left flank and multiple weak bands for the right flank. The left flank was verified by sequencing.