A TI{KozakGAL4} DNA cassette has been inserted into CG5254, replacing the coding sequence (coordinates of deleted sequence are X:756292..758570 , release 6 genome). This results in a simultaneous knock-out of CG5254 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of CG5254 (the insertion is predicted to trap transcript CG5254-RA, but not CG5254-RB). The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: TTGACCCGTAGTGTTCTAGTTGG and AAGAAGGCGCTTGCCTCTTGAGG.