A TI{KozakGAL4} DNA cassette has been inserted into mAChR-C, replacing the coding sequence (coordinates of deleted sequence are X:6831474..6832664 , release 6 genome). This results in a simultaneous knock-out of mAChR-C plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of mAChR-C (predicted to gene trap all annotated transcripts of the gene). The insertion is also within nonC and is not predicted to gene trap this gene. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: TCGTTTACCATCGTGGCTCATGG and GAAGGCCACTCAGTGATCAACGG.