A TI{KozakGAL4} DNA cassette has been inserted into Hip1, replacing the coding sequence (coordinates of deleted sequence are 3L:12768699..12773313 , release 6 genome). This results in a simultaneous knock-out of Hip1 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Hip1 (the insertion is upstream of the 5' end of the Hip1-RB transcript and is not expected to trap it, but is expected to trap the other annotated Hip1 transcript). The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: CAAGAATTGTCAGTAAACAATGG and TTATATCACACCATAGTATGTGG.