A TI{KozakGAL4} DNA cassette has been inserted into a dicistronic transcript that encodes the CG17139 and CG17140-PA coding sequences, deleting the entire CG17139 coding sequence (coordinates of deleted sequence are 2L:10844408..10845591 , release 6 genome). The CG17140-PA coding sequence is not deleted. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: TTCCGTATCCGTTCTCTCATGGG and ATTCATTTCTATGTCATGATGGG.