A TI{KozakGAL4} DNA cassette has been inserted into Porin2, replacing most of the coding sequence (coordinates of deleted sequence are 2L:10845918..10847013 , release 6 genome). This results in a simultaneous knock-out of Porin2 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Porin2 (predicted to gene trap all annotated transcripts of the gene). The downstream end of the deletion associated with the insertion is 254 bp upstream of the annotated TSS of the CG17139 and CG17140 genes (same site for both genes) and may affect their expression. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: TATAAAACTCGATACTGATCAGG and AAGGACGGAAACCATCGGTTCGG.