A TI{KozakGAL4} DNA cassette has been inserted into Rop, replacing the coding sequence (coordinates of deleted sequence are 3L:4136944..4138843 , release 6 genome). This results in a simultaneous knock-out of Rop plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Rop (predicted to gene trap all annotated transcripts of the gene).The upstream end of the deletion associated with the insertion is 233 bp from the annotated TSS of the Ras64B gene on the opposite strand and may affect its expression. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: TTTATTGGTCACGGGCGCAAAGG and AGTTTGTTATTCCTTACCGGAGG.