A TI{CRIMIC.TG4.0} DNA cassette has been inserted into CG3420, in a coding intron, and is predicted to gene trap all annotated transcripts of the gene. In addition, the coding exons of CG3420 downstream of the inserted gene trap cassette have been deleted. The TI{CRIMIC.TG4.0} cassette was inserted via the CRISPR/Cas-9 hybrid technique, using two gRNAs that target CG3420 : one targeted to a coding intron (TAGATCACCCCCTGATTTCAAGG) and the other to a non-coding exon in the 3' UTR (ATAGATTTAGGATTGGTTGTAGG). The 3' end of the deletion associated with the insertion extends to within 44 bp from the annotated 3' end of the Eb1 gene and may affect proper mRNA 3' end formation.