A TI{KozakGAL4} DNA cassette has been inserted into CG16935, replacing the coding sequence (coordinates of deleted sequence are 2R:13860421..13861919 , release 6 genome). This results in a simultaneous knock-out of CG16935 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of CG16935 (predicted to gene trap all annotated transcripts of the gene). The deletion also removes part of Uba3. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: AGTTGGCAGCAATGTAGCGACGG and GCATTTAGATGCGTAACTCGAGG. The 5' end of the deletion associated with the insertion is 78 bp from the 5' end of the CG13344 gene and may affect its expression.