A TI{KozakGAL4} DNA cassette has been inserted into CG3566, replacing the coding sequence (coordinates of deleted sequence are X:6275069..6276650 , release 6 genome). This results in a simultaneous knock-out of CG3566 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of CG3566 (predicted to gene trap all annotated transcripts of the gene). The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: AAGAGCAGGCAGGCGCAGTCAGG and TGGAATCTCGTAATGCAGTCCGG. The 3' end of the deletion associated with the insertion is 85 bp downstream of the 3' end of the Spt6 gene and may affect the proper 3' end formation of its transcripts.