A TI{KozakGAL4} DNA cassette has been inserted into CstF50, replacing the coding sequence (coordinates of deleted sequence are 3R:31735567..31736944 , release 6 genome). This results in a simultaneous knock-out of CstF50 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of CstF50 (predicted to gene trap all annotated transcripts of the gene). The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: TTTCGATAACGATAACGGCACGG and TTTACTGATTATTTGCTCTTCGG. The 5' end of the deletion associated with the insertion is 91 bp from the 5' end of the CG11563 gene and may affect its expression.