A TI{KozakGAL4} DNA cassette has been inserted into Mpv17, replacing the coding sequence (coordinates of deleted sequence are 4:1028654..1029284 , release 6 genome). The 3' end of the deletion extends 21 bp downstream of the annotated 3' end of the Mpv17 gene. This results in a simultaneous knock-out of Mpv17 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Mpv17 (predicted to gene trap all annotated transcripts of the gene). The deletion includes the majority of both asRNA:CR44031 transcripts, but does not delete their small 5' exons. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: TATTTAAAACAATTTGGATCGGG and CTCGACATGTGACTTCGGACTGG.