A TI{KozakGAL4} DNA cassette has been inserted into ND-B22, replacing the coding sequence (coordinates of deleted sequence are 2L:13370351..13370985 , release 6 genome). This results in a simultaneous knock-out of ND-B22 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of ND-B22 (predicted to gene trap all annotated transcripts of the gene). The 3' end of the deletion associated with the insertion is 22 bp from the 3' end of CG31855 and may affect the proper 3' end formation of its transcripts. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: TGTTGTTGTTGCCTCGGCTGCGG and GATTGGATGTGATTTGATTACGG.