A TI{KozakGAL4} DNA cassette has been inserted into Sgsh, replacing the coding sequence (coordinates of deleted sequence are 3R:18911204..18912923 , release 6 genome). This results in a simultaneous knock-out of Sgsh plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Sgsh (predicted to gene trap all annotated transcripts of the gene), although the 5' end of the deletion associated with the insertion coincides with the annotated transcription start site of the Sgsh gene, which may affect the transcription of the Kozak-Gal4 cassette from the Sgsh promoter. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: GACGTCAGCGTACTGAAGTACGG and ATGGTTGAGTTATCAACCATTGG.