A TI{CRIMIC.TG4.0} DNA cassette has been inserted into Mp20, in a coding intron, and is predicted to gene trap all annotated transcripts of the gene. All of the coding sequences of the Mp20-RA transcript downstream of the Trojan-Gal4 cassette are deleted. The coding sequences in exons 2 and 3 of Mp20-RC are deleted, but exons 1 and 4 are not. The TI{CRIMIC.TG4.0} cassette was inserted via the CRISPR/Cas-9 hybrid technique, using two gRNAs that target Mp20 : one targeted to a coding intron (GCGCTTGCCGGCAATCTAGGTGG) and the other to a non-coding exon in the 3' UTR (TAGAGAGCTCAAGGTTATAGAGG).