A TI{CRIMIC.TG4.0} DNA cassette has been inserted into cer, in a coding intron, and is predicted to gene trap all annotated transcripts of the gene. In addition, most but not all of the coding sequences of cer downstream of the inserted gene trap cassette have been deleted. The TI{CRIMIC.TG4.0} cassette was inserted via the CRISPR/Cas-9 hybrid technique, using two gRNAs that target cer : one targeted to a coding intron (TTCTTGTCGAACTTGGACTATGG) and the other to a non-coding exon in the 3' UTR (TTGAGATTCTGTTAATTTGGCGG).
